LOCUS       XM_054355256            1416 bp    mRNA    linear   PRI 26-AUG-2024
DEFINITION  PREDICTED: Homo sapiens glutathione S-transferase alpha 1 (GSTA1),
            transcript variant X1, mRNA.
ACCESSION   XM_054355256
VERSION     XM_054355256.1
DBLINK      BioProject: PRJNA807723
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_060930) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_009914755.1-RS_2024_08
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           RefSeqFE; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 08/23/2024
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1416
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /isolate="CHM13"
                     /db_xref="taxon:9606"
                     /chromosome="6"
                     /sex="female"
                     /cell_line="CHM13htert"
                     /tissue_type="hydatidiform mole"
                     /note="haploid cell line"
     gene            1..1416
                     /gene="GSTA1"
                     /gene_synonym="GST-epsilon; GST2; GSTA1-1; GTH1"
                     /note="glutathione S-transferase alpha 1; Derived by
                     automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 1 mRNA, 97 ESTs, 38 long SRA reads, 2 Proteins, and
                     100% coverage of the annotated genomic feature by RNAseq
                     alignments, including 103 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:2938"
                     /db_xref="HGNC:HGNC:4626"
                     /db_xref="MIM:138359"
     CDS             63..740
                     /gene="GSTA1"
                     /gene_synonym="GST-epsilon; GST2; GSTA1-1; GTH1"
                     /codon_start=1
                     /product="glutathione S-transferase A1 isoform X1"
                     /protein_id="XP_054211231.1"
                     /db_xref="GeneID:2938"
                     /db_xref="HGNC:HGNC:4626"
                     /db_xref="MIM:138359"
                     /translation="

MAEKPKLHYFNARGRMESTRWLLAAAGVEFEEKFIKSAEDLDKLRNDGYLMFQQVPMVEIDGMKLVQTRAILNYIASKYNLYGKDIKERALIDMYIEGIADLGEMILLLPVCPPEEKDAKLALIKEKIKNRYFPAFEKVLKSHGQDYLVGNKLSRADIHLVELLYYVEELDSSLISSFPLLKVTHFTAQRGSPTSPILGSCIWALRLTKFCPSLLQAFSAPRSPK"

     misc_feature    72..308
                     /gene="GSTA1"
                     /gene_synonym="GST-epsilon; GST2; GSTA1-1; GTH1"
                     /note="GST_N family, Class Alpha subfamily; GSTs are
                     cytosolic dimeric proteins involved in cellular
                     detoxification by catalyzing the conjugation of
                     glutathione (GSH) with a wide range of endogenous and
                     xenobiotic alkylating agents, including carcinogens;
                     Region: GST_N_Alpha; cd03077"
                     /db_xref="CDD:239375"
     misc_feature    order(93..95,99..101,105..107,111..116,123..125,132..137,
                     156..158,168..170,267..269,276..281)
                     /gene="GSTA1"
                     /gene_synonym="GST-epsilon; GST2; GSTA1-1; GTH1"
                     /note="C-terminal domain interface [polypeptide binding];
                     other site"
                     /db_xref="CDD:239375"
     misc_feature    order(195..197,222..227,261..266)
                     /gene="GSTA1"
                     /gene_synonym="GST-epsilon; GST2; GSTA1-1; GTH1"
                     /note="GSH binding site (G-site) [chemical binding]; other
                     site"
                     /db_xref="CDD:239375"
     misc_feature    order(216..221,243..245,258..263,267..272,279..284,
                     294..296)
                     /gene="GSTA1"
                     /gene_synonym="GST-epsilon; GST2; GSTA1-1; GTH1"
                     /note="dimer interface [polypeptide binding]; other site"
                     /db_xref="CDD:239375"
     misc_feature    318..>608
                     /gene="GSTA1"
                     /gene_synonym="GST-epsilon; GST2; GSTA1-1; GTH1"
                     /note="C-terminal, alpha helical domain of the Glutathione
                     S-transferase family; Region: GST_C_family; cl02776"
                     /db_xref="CDD:470672"
     misc_feature    order(339..341,360..362,525..527,534..539,546..548,
                     558..560)
                     /gene="GSTA1"
                     /gene_synonym="GST-epsilon; GST2; GSTA1-1; GTH1"
                     /note="N-terminal domain interface [polypeptide binding];
                     other site"
                     /db_xref="CDD:198286"
     misc_feature    order(339..344,351..356,363..365,465..467)
                     /gene="GSTA1"
                     /gene_synonym="GST-epsilon; GST2; GSTA1-1; GTH1"
                     /note="dimer interface [polypeptide binding]; other site"
                     /db_xref="CDD:198286"
     misc_feature    order(360..362,369..374,549..551,558..560)
                     /gene="GSTA1"
                     /gene_synonym="GST-epsilon; GST2; GSTA1-1; GTH1"
                     /note="substrate binding pocket (H-site) [chemical
                     binding]; other site"
                     /db_xref="CDD:198286"
ORIGIN      

gtcgagccaggacggtgacagcgtttaacaaagcttagagaaacctccaggagactgctatcatggcagagaagcccaagctccactacttcaatgcacggggcagaatggagtccacccggtggctcctggctgcagctggagtagagtttgaagagaaatttataaaatctgcagaagatttggacaagttaagaaatgatggatatttgatgttccagcaagtgccaatggttgagattgatgggatgaagctggtgcagaccagagccattctcaactacattgccagcaaatacaacctctatgggaaagacataaaggagagagccctgattgatatgtatatagaaggtatagcagatttgggtgaaatgatcctccttctgcccgtatgtccacctgaggaaaaagatgccaagcttgccttgatcaaggagaaaataaaaaatcgctacttccctgcctttgaaaaagtcttaaagagccatggacaagactaccttgttggcaacaagctgagccgggctgacattcatctggtggaacttctctactacgtcgaggagcttgactccagtcttatctccagcttccctctgctgaaggtgacccatttcacagcccagagaggcagccccacatctcccatcttgggatcttgtatctgggccctgcgactgaccaagttttgccccagtcttctccaggccttcagtgccccaaggtctccaaaatgagcttccaggctccaattttgaggaatgaaaacacttttgttatggaaaggaaatctgtgctgcatgctaccccacaaagagtattttgccctttattatggaaagaacccagggcccagcatctctccccatccctctatttcaatgtggtttctgttcctgagttctctgtgatgtcctttatcccatatgtgcccacagtgagccggtctgagcagagccctttccatctggtttcctccctgggctccggctcctgctgtctgacattgtgttcctctctgcacagctctccaggacactggccccccacactgtatctctcactgagaaaaggtggtcccatggtttgtctttaatattttctataactattcccttcccaaataatttccccatgttttcacttctgcttagagactcatctgtgttgatatctcacaggcacattattttttcttgtcttatacaagagtcactaatctataggattagtgtgtaaggagaaagatagagatgactgaactgattaaaacttcaagacatctttggggaaaataaagtgagctacatgtccttccccttatcttcatttctcactgggtgtctgtttctgcctccatgcttgtgctgatggagcagactcacttggtctttgcaggaggggctcagattc

//