GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-11-15 13:37:09, GGRNA.v2 : RefSeq release 226 (Sep, 2024)

LOCUS       XM_028846928            1230 bp    mRNA    linear   PRI 26-APR-2019
DEFINITION  PREDICTED: Macaca mulatta mucin 21, cell surface associated
            (MUC21), mRNA.
ACCESSION   XM_028846928
VERSION     XM_028846928.1
DBLINK      BioProject: PRJNA528504
KEYWORDS    RefSeq.
SOURCE      Macaca mulatta (Rhesus monkey)
  ORGANISM  Macaca mulatta
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Cercopithecidae; Cercopithecinae; Macaca.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_041757.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Macaca mulatta Annotation Release
                                           103
            Annotation Version          :: 103
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1230
                     /organism="Macaca mulatta"
                     /mol_type="mRNA"
                     /isolate="AG07107"
                     /bio_material="Coriell:AG07107"
                     /db_xref="taxon:9544"
                     /chromosome="4"
                     /sex="female"
                     /tissue_type="fibroblast"
     gene            1..1230
                     /gene="MUC21"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 7 Proteins, and 19% coverage of
                     the annotated genomic feature by RNAseq alignments"
                     /db_xref="GeneID:714502"
     CDS             1..1230
                     /gene="MUC21"
                     /codon_start=1
                     /product="mucin-21"
                     /protein_id="XP_028702761.1"
                     /db_xref="GeneID:714502"
                     /translation="
MKMQKGNVLLTFCLLLHLEAAINPSGTSTSANTGPTVTSSGISTVMNSGPSVTSSGASTATNSASSTTSGGASTATNSESSTATSSEFSTTSSGASTATSSEFSTTSSGASTATSSDSSTPSSGASTATSSDSSTPSTGASTATSSDSSTPSSGASTATSSDSSTTSSGASTVTSSDSSTTSGGTSTATSSESSNLRGPAHTATSSESSTNSGGTSTATSSESSTPSGGASTATSSESSTPSSGAGTATSSESSTTSTGASTATSSDSSTPSSGASTATSSGSSVTSAGSGTPTLTGTHTTSHRVITSASTAVSGAKPGGSLLPWEIFLITLVSVVAAVGLFAGLFFCVRNSLSLRNIFNTAVYRPHGLGPGPGGNRGAPHRPRWSPNWFWRRPVSSIAMEMSGRNNGP"
     misc_feature    55..228
                     /gene="MUC21"
                     /note="Tandem-repeating region of mucin, epiglycanin-like;
                     Region: Epiglycanin_TR; pfam05647"
                     /db_xref="CDD:461702"
     misc_feature    925..1185
                     /gene="MUC21"
                     /note="Mucin, catalytic, TM and cytoplasmic tail region;
                     Region: Epiglycanin_C; pfam14654"
                     /db_xref="CDD:434100"
ORIGIN      
atgaagatgcagaaaggaaatgttctccttacattttgtctactattgcatttagaagccgcaataaatcccagtgggactagcacctctgccaacactggacccactgtgacctccagtgggatcagcacagtcatgaactctgggcccagtgtgacctccagtggggccagcacagccaccaactctgcgtccagcacaacctccggcggggccagcacagccaccaactctgagtccagcacagccaccagctctgagttcagcacaacctccagtggggccagcacagccaccagctctgagttcagcacaacctccagtggagccagcacagccaccagctctgactccagcacaccctccagtggggccagcacagccaccagctctgactccagcacaccctccactggggccagcacagccaccagctctgactccagcacaccctccagtggggccagcacagccaccagctctgactccagcacaacctccagtggggccagcacagtcaccagctctgactccagcacaacctccggtgggaccagcacagccaccagctctgagtccagcaacctccgtgggccagcacacacagccaccagctctgagtccagtacaaactccggtgggaccagcacagccaccagctctgagtccagcacaccctccggtggggccagcacagccaccagctctgagtccagcacaccctccagtggggccggcacagccaccagctctgagtccagcacaacctccactggggccagcacagccaccagctctgactccagcacaccctccagtggggccagcacagccaccagctctgggtccagtgtgacctccgcaggctctggaacacccactctgactgggacgcacacaacttcccacagagttatcacaagtgcctctactgcagtgagtggggcgaagcctggggggtccctgctgccatgggaaatcttcctcatcacgctggtctcggttgtggcggccgtggggctgtttgctgggctcttcttctgtgtgagaaacagcctgtccctgagaaacatctttaacacagctgtctaccgcccccatggccttggcccaggccctggagggaatcgtggagccccccacaggcccaggtggagccctaactggttctggaggagaccagtatcctcgatagccatggagatgagcgggaggaacaacggaccctga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]