LOCUS       XM_028400522            2968 bp    mRNA    linear   VRT 15-JUL-2025
DEFINITION  PREDICTED: Parambassis ranga argonaute RISC catalytic component 3b
            (ago3b), transcript variant X4, mRNA.
ACCESSION   XM_028400522
VERSION     XM_028400522.1
DBLINK      BioProject: PRJNA526690
KEYWORDS    RefSeq.
SOURCE      Parambassis ranga (Indian glassy fish)
  ORGANISM  Parambassis ranga
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Ovalentaria; Ambassidae; Parambassis.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_041023.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_900634625.1-RS_2025_07
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.4
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 07/15/2025
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2968
                     /organism="Parambassis ranga"
                     /mol_type="mRNA"
                     /db_xref="taxon:210632"
                     /chromosome="2"
     gene            1..2968
                     /gene="ago3b"
                     /note="argonaute RISC catalytic component 3b; Derived by
                     automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 4 Proteins, and 99% coverage of the annotated genomic
                     feature by RNAseq alignments, including 3 samples with
                     support for all annotated introns"
                     /db_xref="GeneID:114432490"
     CDS             437..2968
                     /gene="ago3b"
                     /codon_start=1
                     /product="protein argonaute-3 isoform X4"
                     /protein_id="XP_028256323.1"
                     /db_xref="GeneID:114432490"
                     /translation="

MEIGTTGAVGAQALFSLPRRPGYGTIGKPIKLLANCFQVEIPKIDVYLYEVDIKPDRCPRRVNREVVDSMVQHFKVTIFGDRMPVYDGKRSLYTASPLPVATAGVDLDVTLPGEGGKDRPFKVTIRFVSLVSWHMLHEVLTGRITSEPLDLEKPLSTNPVHAVDVVLRHLPSMKYTPVGRSFFSSPEGYDHPLGGGREVWFGFHQSVRPAMWKMMLNIDVSATAFYKAQPVIQFMCEVLDIHNIDEQPRPLTDSHRVKFTKEIKGLKVEVTHCGTMRRKYRVCNVTRRPASLQTFPLQLENGQTVERTVAQYFREKYNLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLVRSANYDADPFVQEFQFRVRDEMAQVTGRVLPAPMLQYGGRVSAEAFMPQQINPALSLQNRTVATPSHGVWDMRGKQFHTGVEIKMWAIACFATQRQCREEILKSFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYAGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINVKLGGINNILVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDAHPSRYCATVRVQRPRQEVIQDLASMVRELLIQFYKSTRYKPTRIIFYRDGVSEGQFRQVLYYELLAIREACISLEKEYQPGITYIVVQKRHHTRLFCADRNERVGRSGNIPAGTTVDTDITHPYEFDFYLCSHAGIQGTSRPSHYHVLWDDNCFTADEFQLLTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKEHDR"

     misc_feature    653..937
                     /gene="ago3b"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:465134"
     misc_feature    965..1117
                     /gene="ago3b"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:462567"
     misc_feature    1118..1480
                     /gene="ago3b"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(1274..1276,1319..1321,1361..1363,1373..1375,
                     1427..1429,1448..1450,1454..1456)
                     /gene="ago3b"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1613..2944
                     /gene="ago3b"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(2078..2080,2090..2092,2126..2137,2144..2146,
                     2168..2170,2177..2179,2189..2191,2201..2203)
                     /gene="ago3b"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(2282..2284,2288..2290,2498..2500,2912..2914)
                     /gene="ago3b"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      

gggcggcgtaagagtagatttcagaccggttcctcgccgatactgaggaggacgccgggccggggagcgtacacatatctgtttgataaaggagccgaaccggattgtcacgttaagatatacggaacaccgaatcctgtcacttctcggctacgacagaaagaacgagaaagaacggaggcggggacattctgttcaactttgagctgtcagtttcggtaaagcaactcgggggagaagacttctagccccgggggggacccctgagcggcccggttccacatcaccgaacgaagccccccggagaaggagagcggggagcaacggagacttaagttagcagcgtatcgagcaacgcatccttaaaaaagaagtgaaagtttgaagggataatcgatcacagagtgccggggtcgtccgggcagagacctcatgaatggaaatcggaacaacaggagccgttggagcacaagccctgttttcgttgccacggcgacccggctatggcaccattgggaagcccatcaagcttctggccaactgcttccaggtggaaatccccaagattgacgtctacctgtacgaggtggacatcaagccggacagatgtcctcgacgtgtcaacagggaggtggtggactccatggtgcagcatttcaaggtgaccatctttggtgaccgcatgcctgtttatgatgggaagagaagcctctatactgcgagcccccttcccgtcgctactgctggggttgatctggacgtcaccctgccaggtgaaggtgggaaggaccgcccctttaaagtgaccattagattcgtgtcattggtcagctggcacatgctgcacgaagtcctgacaggacgcatcacgtctgaaccactggacctggagaaacctctcagcactaaccctgtgcatgctgtggatgttgtgcttcgacatctgccctccatgaagtacacccctgttggccgatccttcttctcctccccagagggctacgaccatccgctaggtggagggagggaagtttggttcggcttccatcagtcagtacgcccagccatgtggaagatgatgctcaatattgatgtgtcagccactgctttctataaggcccagcctgtcattcagttcatgtgcgaggtcctggacattcacaacattgacgagcagccgcgccctctcactgattcgcacagggtcaagttcaccaaagagatcaaaggtcttaaagtggaagtgacacactgtggaaccatgcgtaggaagtacagagtatgcaacgtaacgcggcgccctgccagcctccagacatttccattgcagcttgagaacggtcagacagtggagcgcactgtggcccagtacttccgggagaaatacaacctgcagctgaaatatccccatctgccatgtctgcaggtgggccaggagcagaagcacacctacctgcctctggaggtgtgtaacattgttgctggacagcgctgtattaaaaaactcaccgacaaccagacatcaaccatgatcaaagcaactgcgcggtctgccccggacagacaggaggagatcagcaggctggtgcggagtgcgaactacgacgccgacccgttcgtccaggagtttcagttccgcgtgcgagatgagatggctcaggtgacgggtcgtgtcctgccagcccccatgctgcagtatggcggcagggtgagcgctgaggccttcatgccccagcagatcaaccctgcactatcgttgcagaaccgcacggttgccacacccagccatggggtgtgggatatgagggggaagcagtttcacaccggagtagagatcaagatgtgggccatcgcctgctttgccacccagaggcagtgcagagaagagatcctcaagagcttcaccgatcagctgcggaaaatctcaaaggatgctgggatgccaatccaagggcagccatgtttctgtaaatacgcccaaggagctgacagtgtggagcccatgttcagacacctgaagaacacctacgccggactacagctcatcatcgttatccttcctggaaaaacacccgtctatgctgaggtgaagcgagtgggggacacgcttctcggcatggccacgcagtgcgtgcaggtgaagaacgtggtgaagacgtcccctcagacactctctaacctctgcctcaagatcaacgtcaaactgggaggcatcaacaacatcctggttccacaccagcgaccctccgtgttccagcagcctgtcatcttcctcggggctgatgtcactcatcctcctgcaggagatgggaagaagccatctattgcagctgtagttggcagtatggatgcccaccccagcaggtattgtgctactgtgcgggtccagaggcccagacaggaggttattcaggacttggcttctatggtgcgtgagctcttgattcagttctacaaatcaactcgctacaagcccaccaggatcatcttctacagggacggagtgtcagagggccagttcagacaggtgctgtattatgagctgctggccatcagggaggcgtgcatcagtctagagaaggaataccagccggggatcacctacattgtcgtgcaaaaacggcatcacacgcgcctcttctgtgcagatcgcaatgagcgcgttggacgaagtggaaacattcctgccggcaccactgtggacacggacatcacccacccgtacgagtttgacttttacctctgcagtcacgctgggatccagggtacgagccggccttcccactaccacgtactgtgggacgacaactgtttcaccgcagacgagttccagctactcacctaccagctgtgccacacctacgtccgctgcacgcgctccgtttctatcccagcaccggcgtactacgcccacctggtggccttccgcgctcgctaccacctggttgacaaagagcacgacaggtag

//