GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-11-15 19:03:47, GGRNA.v2 : RefSeq release 226 (Sep, 2024)

LOCUS       XM_020761848            2015 bp    mRNA    linear   INV 10-APR-2017
DEFINITION  PREDICTED: Orbicella faveolata protein argonaute-2-like
            (LOC110055455), transcript variant X2, mRNA.
ACCESSION   XM_020761848
VERSION     XM_020761848.1
DBLINK      BioProject: PRJNA381078
KEYWORDS    RefSeq.
SOURCE      Orbicella faveolata
  ORGANISM  Orbicella faveolata
            Eukaryota; Metazoa; Cnidaria; Anthozoa; Hexacorallia; Scleractinia;
            Faviina; Merulinidae; Orbicella.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_018149549.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Orbicella faveolata Annotation
                                           Release 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.3
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2015
                     /organism="Orbicella faveolata"
                     /mol_type="mRNA"
                     /isolate="FL"
                     /db_xref="taxon:48498"
                     /chromosome="Unknown"
                     /sex="hermaphrodite"
                     /tissue_type="whole organism"
                     /dev_stage="adult"
                     /geo_loc_name="Panama"
                     /collection_date="Aug-2013"
                     /collected_by="Nancy Knowlton"
                     /identified_by="Nancy Knowlton"
     gene            1..2015
                     /gene="LOC110055455"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 56 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 5 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:110055455"
     CDS             25..1650
                     /gene="LOC110055455"
                     /codon_start=1
                     /product="protein argonaute-2-like isoform X2"
                     /protein_id="XP_020617507.1"
                     /db_xref="GeneID:110055455"
                     /translation="
MSAIKHRILNGHPILGYFISVSTKGFYKKQNVIDFLCETLGRDVTPQSLQNRHFQLDKHRLEKAIRGIRIQATHAAAIKRKYKVWGVSSDPAEKLQFVVEDGVTGRKSKTTEAEYFKNKYKLHLRYPHLPCLLAGQKRDRYLPLEVCTIIPCQKRHLSEEQTANMIRSTARPAPERQQDIQYWVESLFSQWAVDYPQLQLIIAVLPDKAKELYSEIKRVGDIVLGIATQCVKIQHAQQAKPQVCANISLKINSKLGGINHVIDPSEKSPVFRDPVIIFGADVTHPTPTENGIPSIAAVAASMDVNATKYCARVRAQRHEKSRGPQEIINDLAVMVKELLIEFYKANWRRKPSTIIFYRDGVSESQFDQVLIHEVRAVQVACMMLEKEYRPRITFVVAQKRHHTRLFCEDRRDASGKAQNVPPGTTVDGGITHPYEFDFYLCSHYGIQGTSRPTHYHVLYDDNAFTADGLQQLTYQLCHVYARCTRSVSIPAPAYYAHLVAFRARRHMTNGENGRRGDTVDLEKSARAIQVHDRMKEAMYFT"
     misc_feature    112..474
                     /gene="LOC110055455"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(268..270,313..315,358..360,370..372,424..426,
                     442..444,448..450)
                     /gene="LOC110055455"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    <610..1545
                     /gene="LOC110055455"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(661..663,673..675,709..720,727..729,751..753,
                     760..762,772..774,784..786)
                     /gene="LOC110055455"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(865..867,871..873,1099..1101,1513..1515)
                     /gene="LOC110055455"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
gcccagtagacataaagtcagcttatgtctgcaattaaacatcgaatattgaatggccatcctattcttggctattttatttcagtctctacaaaaggtttctacaagaaacaaaacgtcatagacttcctatgtgaaactcttggacgagatgtaacaccccaaagtctccaaaaccgtcactttcagcttgataaacatagacttgagaaggccatacgtggaattcgtatacaagctactcatgcagccgctattaagagaaagtacaaagtatggggagtatcaagtgaccccgcagaaaagctacagtttgtagtcgaggatggagtaactggtcgcaaaagcaaaacaaccgaggcagagtattttaagaataaatacaagttgcatttgagatatcctcacctaccctgtctactagctggccaaaaaagggaccgttacctgccactagaagtctgtaccataattccttgtcaaaaaaggcatttatcagaggaacagacggcaaacatgatcagaagtactgctcgccctgcacctgaaaggcaacaggacattcagtattgggtggaaagtctattctctcagtgggcggtagattatccacaactacagcttatcatagctgttctgccagataaagccaaggaactttattcagagatcaaacgagttggcgacattgtcctaggaattgccacccaatgtgttaaaattcagcacgcacaacaagcgaaacctcaagtctgtgccaatatctctttgaagataaactccaagttaggtggaattaatcatgtgattgatccgtcagagaagtcccccgtgtttagagatcctgttatcatctttggtgcggatgtaacacaccccactcctactgaaaatgggattccatctatcgctgctgttgcggccagtatggatgtaaatgcaaccaaatattgcgcacgggttcgagcgcagagacacgagaagtctagaggtcctcaggaaattattaacgatctggctgtcatggttaaagagcttcttatcgagttctacaaagcgaattggagacgtaagccgtccacaatcattttttaccgtgatggagtcagtgaaagtcagtttgaccaagtactgattcatgaagtgcgagctgttcaggtggcctgtatgatgctggaaaaggaatatcgtccaagaatcacttttgttgtggctcagaagcgccaccacacaagactgttctgtgaagacagacgagatgcttcagggaaagctcagaatgtaccaccaggcaccactgtggatggtggtataacacacccatatgagtttgatttctacctgtgcagccactatggaatccagggaacaagccgacccactcactatcacgttttgtacgacgataacgcctttacagcagacggtcttcaacagctcacttatcagctgtgccacgtatatgcacgttgcactcgcagtgtctccataccagcccccgcctattatgcacatttggtagcatttcgagccagacgccacatgaccaacggcgaaaatggaaggaggggggacactgtagatttggagaaatctgcaagagccattcaagttcatgacagaatgaaagaagcgatgtattttacgtaaacaattaacatgataatactgtatatatgtgctcgaaatgaaaaaaaagaaaagaaaaagatgaaaaatacatcgctgacaagtagcaataccgcgtaaatgtctccatgaataacaactgtttatgagaatatgtaatcctgatattccattagttttaaatattttttcctgacttttaggttgcaagtgatttgaaaacggtgatgcattctgctacatgtagttagcattccggggggaactcccatataaaaaggacaggggtggtcatcgtaccttttagggcttaagagtgaggttttggtacctcttagggtgttcggcctgaagtgatccacagagggagcttttacggtgccttt
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]