GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-04-20 13:53:12, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       XM_015284816             917 bp    mRNA    linear   VRT 01-MAR-2022
DEFINITION  PREDICTED: Gallus gallus glutathione S-transferase alpha 4 (GSTA4),
            transcript variant X1, mRNA.
ACCESSION   XM_015284816
VERSION     XM_015284816.4
DBLINK      BioProject: PRJNA698609
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_052534.1) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Mar 1, 2022 this sequence version replaced XM_015284816.3.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Gallus gallus Annotation Release 106
            Annotation Version          :: 106
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 9.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..917
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /isolate="bGalGal1"
                     /db_xref="taxon:9031"
                     /chromosome="3"
                     /sex="female"
                     /tissue_type="blood"
                     /geo_loc_name="USA: Fayetteville"
                     /lat_lon="36.0822 N 94.1719 W"
                     /collection_date="20-May-2019"
                     /collected_by="Nick Anthony"
     gene            1..917
                     /gene="GSTA4"
                     /gene_synonym="GSTA3; GSTA4L"
                     /note="glutathione S-transferase alpha 4; Derived by
                     automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 8 mRNAs, 1 EST, 7116 long SRA reads, 40 Proteins, and
                     100% coverage of the annotated genomic feature by RNAseq
                     alignments, including 73 samples with support for all
                     annotated introns"
                     /db_xref="CGNC:49401"
                     /db_xref="GeneID:395612"
     misc_feature    1
                     /gene="GSTA4"
                     /gene_synonym="GSTA3; GSTA4L"
                     /experiment="COORDINATES: cap analysis [ECO:0007248]"
                     /note="transcription start site"
     CDS             86..757
                     /gene="GSTA4"
                     /gene_synonym="GSTA3; GSTA4L"
                     /codon_start=1
                     /product="glutathione S-transferase alpha 4 isoform X1"
                     /protein_id="XP_015140302.1"
                     /db_xref="GeneID:395612"
                     /db_xref="CGNC:49401"
                     /translation="
MSGKPRLTYVNGRGRMESIRWLLSAAGVEFEEIFLETREQLLKLCQDGSLLFHQLPLVEIDGMKLVQCRAILSYIAGKYNLYGKDLKERALIDMYVEGISDLMQLILVFPFSPPEAKEKNLATIAEKATERYFPVFEKVLKQHGQDFLVGNRFSWADVQLMEAILAVEEKVPSVLSGFPQLQAFKTKMSNMPTIKKFLQPGSPRKPPPDEHYVATVKKIFKLN"
     misc_feature    95..331
                     /gene="GSTA4"
                     /gene_synonym="GSTA3; GSTA4L"
                     /note="The thioredoxin (TRX)-like superfamily is a large,
                     diverse group of proteins containing a TRX fold. Many
                     members contain a classic TRX domain with a redox active
                     CXXC motif. They function as protein disulfide
                     oxidoreductases (PDOs), altering the redox...; Region:
                     Protein Disulfide Oxidoreductases and Other Proteins with
                     a Thioredoxin fold; cl00388"
                     /db_xref="CDD:469754"
     misc_feature    341..745
                     /gene="GSTA4"
                     /gene_synonym="GSTA3; GSTA4L"
                     /note="C-terminal, alpha helical domain of Class Alpha
                     Glutathione S-transferases; Region: GST_C_Alpha; cd03208"
                     /db_xref="CDD:198317"
     misc_feature    order(341..346,350..352,362..370,374..379,386..388,
                     476..478)
                     /gene="GSTA4"
                     /gene_synonym="GSTA3; GSTA4L"
                     /note="dimer interface [polypeptide binding]; other site"
                     /db_xref="CDD:198317"
     misc_feature    order(374..376,395..397,404..406,413..418,476..481,
                     488..490,539..550,557..559,566..571,578..583,590..592,
                     662..667,671..688)
                     /gene="GSTA4"
                     /gene_synonym="GSTA3; GSTA4L"
                     /note="N-terminal domain interface [polypeptide binding];
                     other site"
                     /db_xref="CDD:198317"
     misc_feature    order(386..388,404..406,416..418,476..478,707..709,
                     731..733,743..745)
                     /gene="GSTA4"
                     /gene_synonym="GSTA3; GSTA4L"
                     /note="substrate binding pocket (H-site) [chemical
                     binding]; other site"
                     /db_xref="CDD:198317"
     polyA_site      917
                     /gene="GSTA4"
                     /gene_synonym="GSTA3; GSTA4L"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      
aaaccagaggtgagactgtgcctgtaagcagtggagactgagttcagaagcttaatatttttcaaggcaccaggagctcagaagcatgtcggggaagcccaggctcacctatgtcaatgggagagggcgaatggagtccatccgatggctgctgtctgcagctggagtggagtttgaagaaatttttctggaaacaagagagcagttattgaagttatgccaagatggatccctgctgttccatcaactgccactggttgagatcgacgggatgaagttggtgcagtgcagagccatcctcagctacatcgcagggaaatacaatctctatgggaaagacctgaaggagagagccctgatcgacatgtatgtggaaggaatatcagacctgatgcaattgattttggtgtttcctttctctccacctgaggcaaaggagaaaaatcttgccacaattgcagagaaggcaacagagaggtacttccctgtctttgaaaaggttttgaaacagcatggccaagactttcttgtgggaaaccgattcagctgggcagatgttcagctcatggaagccattttagcagtggaggagaaagtgccttctgtgctttctgggtttcctcagctgcaggcttttaaaaccaaaatgagcaacatgcctacaattaagaagttcctgcagcctggcagcccaaggaagcccccaccagatgaacattatgtagcaactgtgaagaaaatttttaagctaaactgagtgcagtgttaacttcactaagtcccaaagtgctgggaagaaagacatcaaaacccaaaaccttaaaggaagtaggaaactcagtaaagttttattgtacttaaaagcaatggtagaaataatagaagagtgaaataaagcattctgtttggcaatgtga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]