GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-04-22 05:26:22, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       XM_014882943             792 bp    mRNA    linear   VRT 02-DEC-2015
DEFINITION  PREDICTED: Sturnus vulgaris alkaline ceramidase 1 (ACER1), mRNA.
ACCESSION   XM_014882943
VERSION     XM_014882943.1
DBLINK      BioProject: PRJNA304638
KEYWORDS    RefSeq.
SOURCE      Sturnus vulgaris (Common starling)
  ORGANISM  Sturnus vulgaris
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Neoaves; Telluraves; Australaves;
            Passeriformes; Sturnidae; Sturnus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_014650615.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Sturnus vulgaris Annotation Release
                                           100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 6.5
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..792
                     /organism="Sturnus vulgaris"
                     /mol_type="mRNA"
                     /isolate="715"
                     /db_xref="taxon:9172"
                     /chromosome="Unknown"
                     /sex="male"
                     /dev_stage="adult"
     gene            1..792
                     /gene="ACER1"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 8 Proteins"
                     /db_xref="GeneID:106857101"
     CDS             1..792
                     /gene="ACER1"
                     /codon_start=1
                     /product="alkaline ceramidase 1"
                     /protein_id="XP_014738429.1"
                     /db_xref="GeneID:106857101"
                     /translation="
MPSIFSYQSAEVDWCENNFERSAVIAEYYNTISNVSFFVLSPALLYLNRQYCQKKALPLYFVSGLLLLVGVFSMYFHMTLSYVGQLLDELSILWTLAVAYSFWYPQAYFPKCIKTRRHFFWLTGITTVISTLMSFIKPTLNAYALNCIAFHLLYMTWKELKKCNDKRVHRMAAVMVMWWVLAITSWISDRWLCWLWQAINFPYFHSFWHVLIAMSLLYCCPLVIYFDVTYEMPSFKPKLEYWPSDSWPVVVPYVTLEESHKQC"
     misc_feature    16..753
                     /gene="ACER1"
                     /note="Region: Ceramidase; pfam05875"
                     /db_xref="CDD:461766"
ORIGIN      
atgccgagcatattttcctaccagagtgccgaggtggattggtgtgagaacaacttcgagcgctcggcggtgattgccgagtactacaacaccatcagcaatgtgagtttctttgtgctgtcccctgcactgctgtacctgaacaggcagtactgccagaagaaggctctgcccctctactttgtgtcggggctgctcctcctcgtaggtgtcttctccatgtacttccacatgaccctgagctacgtgggtcagctcttggatgaactctccatcctctggacactggctgtggcttattccttctggtacccacaggcttacttccccaagtgcatcaagaccaggagacatttcttctggctgactgggatcaccaccgtcatcagcaccttgatgtctttcatcaagccgaccctcaatgcctacgcactgaactgcatcgccttccacctgctctacatgacctggaaggagctcaagaagtgcaatgacaaacgtgttcaccggatggctgcagtcatggtgatgtggtgggtactggccatcaccagctggatcagtgaccgctggctctgctggctctggcaggccatcaacttcccctacttccacagcttctggcacgtgctgatagccatgtccctgctctactgctgccccctggtcatctacttcgacgtcacctacgagatgccctcgttcaagccaaagctggaatactggcccagtgactcgtggcctgttgtggtgccctatgtcaccctagaggaatcccacaagcagtgctag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]