LOCUS       XM_008938519             971 bp    mRNA    linear   VRT 02-SEP-2014
DEFINITION  PREDICTED: Merops nubicus ClpB caseinolytic peptidase B homolog (E.
            coli) (CLPB), partial mRNA.
ACCESSION   XM_008938519
VERSION     XM_008938519.1
DBLINK      BioProject: PRJNA253837
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Merops nubicus (carmine bee-eater)
  ORGANISM  Merops nubicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Neoaves; Telluraves;
            Coraciimorphae; Coraciiformes; Meropidae; Merops.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_008602962.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Merops nubicus Annotation Release
                                           100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 6.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 1% of CDS bases
            ##RefSeq-Attributes-END##
            COMPLETENESS: incomplete on the 5' end.
FEATURES             Location/Qualifiers
     source          1..971
                     /organism="Merops nubicus"
                     /mol_type="mRNA"
                     /isolate="BGI_N331"
                     /db_xref="taxon:57421"
                     /chromosome="Unknown"
                     /sex="female"
     gene            <1..971
                     /gene="CLPB"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 6 Proteins"
                     /db_xref="GeneID:103771229"
     CDS             <1..971
                     /gene="CLPB"
                     /codon_start=3
                     /product="caseinolytic peptidase B protein homolog"
                     /protein_id="XP_008936767.1"
                     /db_xref="GeneID:103771229"
                     /translation="

KTELAKQTAKYIHKDVKKGFIRLDMSEFQERHEVAKFIGSPPGYVGHEEGGQLTKKLRQCPNAVVLFDEVDKAHPDVLTIMLQLFDEGRLTDGKGKTIDCKDAIFIMTSNVASDEIAQHALQLRQEAMEMSKNRIAENLEDVQMTDKITISKQFKEKVIRPILKAHFRRDEFLGRINEIVYFLPFCHSELIQLVNKELNFWAKKAKARHNITLLWDREVMDVLADGYNLHYGARSIKHEVERRVVNQLAAAYEQDLLPRGCTLRVTVEDSDKQLLKTQDGASSSAEKARTPTLRLEIVEKGSKSRKLDIQAPLNPENISYLL"

     misc_feature    <1..809
                     /gene="CLPB"
                     /note="ATP-dependent Clp protease, ATP-binding subunit
                     ClpA [Posttranslational modification, protein turnover,
                     chaperones]; Region: ClpA; COG0542"
                     /db_xref="CDD:440308"
ORIGIN      

gtaaaacggagctggccaagcagacagccaagtacatccacaaggacgtcaaaaagggtttcatcagactggacatgtcagagttccaggagagacacgaggttgccaagtttatcggctctccaccgggctacgtgggccacgaagagggtgggcagctcaccaaaaagctcaggcagtgtccgaatgccgtggtgctcttcgacgaggtggacaaagcccacccagatgtcctcaccatcatgctgcagctgtttgatgagggcaggctgacggatgggaaggggaagaccatcgactgcaaggatgccatcttcatcatgacctccaacgtggcgagcgatgagatcgcccagcacgcgctgcagctccgacaagaggccatggagatgagcaagaacaggatcgcagagaacttagaggatgtccagatgaccgacaagatcaccatctccaagcagttcaaggagaaggttattcgccccatcttgaaggctcacttcaggcgagatgagttcctggggaggatcaatgagattgtctacttcctccccttctgccactcggagctcatccagctcgtcaacaaggagctgaatttttgggccaagaaggccaaggcaaggcacaacatcaccctgctctgggacagggaggtcatggacgtgttggctgatggctacaacttgcactatggtgcccggtctatcaaacatgaggtggagcgtcgcgtcgtgaaccagctggcagccgcctacgagcaggacctgctgcccaggggctgcaccttgagggtcacagtggaggactcagacaagcagctgctgaagacccaggatggtgcttccagcagtgcagagaaggccaggacaccgacgctgcggctggagatcgtggagaagggcagcaagtcccgaaagctggacatccaggcacccctgaaccccgagaacatttcctacctcttgtag

//