GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-11-15 18:49:33, GGRNA.v2 : RefSeq release 226 (Sep, 2024)

LOCUS       NR_075229                114 bp    rRNA    linear   BCT 02-FEB-2015
DEFINITION  Clostridium kluyveri NBRC 12016 strain NBRC 12016 5S ribosomal RNA,
            complete sequence.
ACCESSION   NR_075229
VERSION     NR_075229.1
DBLINK      Project: 188106
            BioProject: PRJNA188106
KEYWORDS    RefSeq.
SOURCE      Clostridium kluyveri NBRC 12016
  ORGANISM  Clostridium kluyveri NBRC 12016
            Bacteria; Bacillota; Clostridia; Eubacteriales; Clostridiaceae;
            Clostridium.
REFERENCE   1
  AUTHORS   Inui,M., Nonaka,H., Shinoda,Y., Ikenaga,Y., Abe,M., Naito,K.,
            Vertes,A.A. and Yukawa,H.
  TITLE     Complete genome sequence of Clostridium kluyveri and comaprative
            genomics of Clostridia species
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 114)
  CONSRTM   NCBI RefSeq Targeted Loci Project
  TITLE     Direct Submission
  JOURNAL   Submitted (14-FEB-2013) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 114)
  AUTHORS   Nonaka,H., Shinoda,Y., Ikenaga,Y., Abe,M., Naito,K., Inui,M. and
            Yukawa,H.
  TITLE     Direct Submission
  JOURNAL   Submitted (07-SEP-2005) Contact:Masayuki Inui Research Institute of
            Innovative Technology for the Earth (RITE), Microbiology research
            group; 9-2 Kizugawadai Kizu-cho, Soraku-gun, Kyoto 619-0292, Japan
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence is identical to AP009049:14368-14481.
            COMPLETENESS: full length.
FEATURES             Location/Qualifiers
     source          1..114
                     /organism="Clostridium kluyveri NBRC 12016"
                     /mol_type="rRNA"
                     /strain="NBRC 12016"
                     /type_material="type strain of Clostridium kluyveri"
                     /db_xref="taxon:583346"
                     /note="type strain of Clostridium kluyveri NBRC 12016"
     rRNA            1..114
                     /product="5S ribosomal RNA"
ORIGIN      
tctggtggcaataacgtggaggcaacaccccttaccatttcgaacaggaaggttaagttccacagtgcccatggtactgcaggggaggccctgtgggagagcaggtcgctgccg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]