GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-02-23 11:46:12, GGRNA.v2 : RefSeq release 228 (Jan, 2025)

LOCUS       NM_023951                567 bp    mRNA    linear   ROD 07-OCT-2024
DEFINITION  Rattus norvegicus SEBOX homeobox (Sebox), mRNA.
ACCESSION   NM_023951
VERSION     NM_023951.1
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 567)
  AUTHORS   Moreno,D.L., Salazar,Z., Betancourt,M., Casas,E., Ducolomb,Y.,
            Gonzalez,C. and Bonilla,E.
  TITLE     Sebox plays an important role during the early mouse oogenesis in
            vitro
  JOURNAL   Zygote 22 (1), 64-68 (2014)
   PUBMED   22805237
REFERENCE   2  (bases 1 to 567)
  AUTHORS   Kim,K.H., Kim,E.Y. and Lee,K.A.
  TITLE     SEBOX is essential for early embryogenesis at the two-cell stage in
            the mouse
  JOURNAL   Biol Reprod 79 (6), 1192-1201 (2008)
   PUBMED   18753614
REFERENCE   3  (bases 1 to 567)
  AUTHORS   Cinquanta,M., Rovescalli,A.C., Kozak,C.A. and Nirenberg,M.
  TITLE     Mouse Sebox homeobox gene expression in skin, brain, oocytes, and
            two-cell embryos
  JOURNAL   Proc Natl Acad Sci U S A 97 (16), 8904-8909 (2000)
   PUBMED   10922053
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AF284338.1.
            
            ##Evidence-Data-START##
            RNAseq introns :: single sample supports all introns SAMEA5756307,
                              SAMEA5760400 [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..567
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="Sprague-Dawley"
                     /db_xref="taxon:10116"
                     /chromosome="10"
                     /map="10q25"
     gene            1..567
                     /gene="Sebox"
                     /gene_synonym="Og9x"
                     /note="SEBOX homeobox"
                     /db_xref="GeneID:58922"
                     /db_xref="RGD:62077"
     CDS             1..567
                     /gene="Sebox"
                     /gene_synonym="Og9x"
                     /note="homeobox OG-9; skin-, embryo-, brain- and
                     oocyte-specific homeobox; OG9 homeobox"
                     /codon_start=1
                     /product="homeobox protein SEBOX"
                     /protein_id="NP_076441.1"
                     /db_xref="GeneID:58922"
                     /db_xref="RGD:62077"
                     /translation="
MASPVEASPGCASGLGPHRRKRTTFSVGQLLELERVFAARPYPDISTREHLAQITHLPEAKIQVWFQNRRAKRIKDRKPGALNARLELPPNCSLPDTPQLSWDPGTPSHPLHSTSSAQQTSACPPQTSCLAPILGPGQSWSGAKAAAPWGTSEVSGVHSLEQIVPQTSLGNLSDLIYTSAIVTNVDHS"
     misc_feature    <37..363
                     /gene="Sebox"
                     /gene_synonym="Og9x"
                     /note="Homeodomain-containing transcription factor
                     [Transcription]; Region: COG5576"
                     /db_xref="CDD:227863"
     misc_feature    55..216
                     /gene="Sebox"
                     /gene_synonym="Og9x"
                     /note="Region: Homeodomain; pfam00046"
                     /db_xref="CDD:459649"
     misc_feature    238..375
                     /gene="Sebox"
                     /gene_synonym="Og9x"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9ERS8.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     exon            1..28
                     /gene="Sebox"
                     /gene_synonym="Og9x"
                     /inference="alignment:Splign:2.1.0"
     exon            29..189
                     /gene="Sebox"
                     /gene_synonym="Og9x"
                     /inference="alignment:Splign:2.1.0"
     exon            190..567
                     /gene="Sebox"
                     /gene_synonym="Og9x"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
atggccagtcctgtggaggcatctccaggctgtgccagtgggttgggtccccatcggaggaagaggaccacttttagtgttgggcagttgctggagctggaacgggtatttgcagctaggccctatcctgacatcagcacccgtgagcacctggctcagataactcacctgccagaagccaagatccaggtgtggttccagaaccgtcgagccaagagaatcaaggacagaaagccaggagccctaaacgccaggctggagcttcccccaaactgttctcttccagacactccccagctatcttgggaccctggaacaccaagccatcctctacactctaccagttcagctcagcagacttcggcatgcccaccacagacctcctgcctagcccccattttgggtccagggcagagttggtcaggggctaaagctgcagccccatgggggacaagtgaggtgtcaggagttcactctttagagcaaattgttcctcagacttcactgggcaacctgtctgaccttatctatacctcagccatcgtcaccaatgtagaccactcctaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]