LOCUS       NM_001025225            1218 bp    mRNA    linear   MAM 02-JUN-2024
DEFINITION  Sus scrofa aurora kinase A (AURKA), mRNA.
ACCESSION   NM_001025225
VERSION     NM_001025225.1
KEYWORDS    RefSeq.
SOURCE      Sus scrofa (pig)
  ORGANISM  Sus scrofa
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Suina; Suidae;
            Sus.
REFERENCE   1  (bases 1 to 1218)
  AUTHORS   Komrskova,P., Susor,A., Malik,R., Prochazkova,B., Liskova,L.,
            Supolikova,J., Hladky,S. and Kubelka,M.
  TITLE     Aurora kinase A is not involved in CPEB1 phosphorylation and cyclin
            B1 mRNA polyadenylation during meiotic maturation of porcine
            oocytes
  JOURNAL   PLoS One 9 (7), e101222 (2014)
   PUBMED   24983972
  REMARK    GeneRIF: Aurora kinase A is unlikely to be involved in CPEB1
            activating phosphorylation and cyclin B1 mRNA polyadenylation
            during meiotic maturation of porcine oocytes.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 1218)
  AUTHORS   Nishimura,Y., Kano,K. and Naito,K.
  TITLE     Porcine CPEB1 is involved in Cyclin B translation and meiotic
            resumption in porcine oocytes
  JOURNAL   Anim Sci J 81 (4), 444-452 (2010)
   PUBMED   20662813
REFERENCE   3  (bases 1 to 1218)
  AUTHORS   Nishimura,Y., Endo,T., Kano,K. and Naito,K.
  TITLE     Porcine Aurora A accelerates Cyclin B and Mos synthesis and
            promotes meiotic resumption of porcine oocytes
  JOURNAL   Anim Reprod Sci 113 (1-4), 114-124 (2009)
   PUBMED   18614302
  REMARK    GeneRIF: Aurora A stimulates the protein synthesis and promotes the
            meiotic resumption.
REFERENCE   4  (bases 1 to 1218)
  AUTHORS   Yao,L.J. and Sun,Q.Y.
  TITLE     Characterization of aurora-a in porcine oocytes and early embryos
            implies its functional roles in the regulation of meiotic
            maturation, fertilization and cleavage
  JOURNAL   Zygote 13 (1), 23-30 (2005)
   PUBMED   15984158
  REMARK    GeneRIF: Aurora-A may be a multifunctional kinase that plays
            pivotal regulatory roles in microtubule assembly during porcine
            oocyte meiotic maturation, fertilization and early embryonic
            mitosis
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AB196773.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AB196773.1, SRR5120059.330090.1
                                           [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           SAMEA103886111, SAMEA103886112
                                           [ECO:0000350]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..1218
                     /organism="Sus scrofa"
                     /mol_type="mRNA"
                     /db_xref="taxon:9823"
                     /chromosome="17"
                     /map="17"
     gene            1..1218
                     /gene="AURKA"
                     /gene_synonym="ARK-1; STK6"
                     /note="aurora kinase A"
                     /db_xref="GeneID:574063"
     CDS             1..1218
                     /gene="AURKA"
                     /gene_synonym="ARK-1; STK6"
                     /EC_number="2.7.11.1"
                     /note="serine/threonine kinase 6; aurora-A;
                     Serine/threonine-protein kinase 6;
                     serine/threonine-protein kinase aurora-A; aurora 2;
                     aurora-related kinase 1; aurora/IPL1-related kinase 1;
                     serine/threonine-protein kinase 15; ipl1- and
                     aurora-related kinase 1; serine/threonine-protein kinase
                     Ayk1"
                     /codon_start=1
                     /product="aurora kinase A"
                     /protein_id="NP_001020396.1"
                     /db_xref="GeneID:574063"
                     /translation="

MDKCKENCISGLKTTVPPGDGPKRVPVTQHFPAQHLPSANSGQAQRVLCPSNSSQRLPSHTQKLVSSHKPVQNLKQKQSQATSGPRPVSRPLSNTQQSEQPQPAAPGNNPEKEAASKQKNEESKKRQWALEDFEIGRPLGKGKFGNVYLAREKQSKFILALKVLFKTQLEKAGVEHQLRREVEIQSHLRHPNILRLYGYFHDATRVYLILEYAPLGAVYRELRELQKLSKFDEQRTATYITELANALSYCHSKRVIHRDIKPENLLLGSAGELKIADFGWSVHAPSSRRTTLCGTLDYLPPEMIEGRMHDEKVDLWSLGVLCYEFLVGKPPFEANTYQETYKRISRVEFTFPDFAPEGARDLISRLLKHNPSHRPTLKEVLEHPWITANSKPASSHKKESTSKQP"

     misc_feature    1..375
                     /gene="AURKA"
                     /gene_synonym="ARK-1; STK6"
                     /note="propagated from UniProtKB/Swiss-Prot (A5GFW1.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    121..123
                     /gene="AURKA"
                     /gene_synonym="ARK-1; STK6"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:O14965; propagated from
                     UniProtKB/Swiss-Prot (A5GFW1.1); phosphorylation site"
     misc_feature    151..153
                     /gene="AURKA"
                     /gene_synonym="ARK-1; STK6"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:O14965; propagated from
                     UniProtKB/Swiss-Prot (A5GFW1.1); phosphorylation site"
     misc_feature    379..1161
                     /gene="AURKA"
                     /gene_synonym="ARK-1; STK6"
                     /note="The protein kinase superfamily is mainly composed
                     of the catalytic domains of serine/threonine-specific and
                     tyrosine-specific protein kinases. It also includes RIO
                     kinases, which are atypical serine protein kinases,
                     aminoglycoside phosphotransferases; Region: Protein
                     Kinases, catalytic domain; cl21453"
                     /db_xref="CDD:473864"
     misc_feature    order(415..426,433..435,439..441,478..480,484..486,
                     580..582,628..639,775..777,787..792,796..798,826..831)
                     /gene="AURKA"
                     /gene_synonym="ARK-1; STK6"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:271018"
     misc_feature    847..888
                     /gene="AURKA"
                     /gene_synonym="ARK-1; STK6"
                     /note="propagated from UniProtKB/Swiss-Prot (A5GFW1.1);
                     Region: Activation segment.
                     /evidence=ECO:0000250|UniProtKB:O14965"
     misc_feature    868..870
                     /gene="AURKA"
                     /gene_synonym="ARK-1; STK6"
                     /note="Phosphothreonine.
                     /evidence=ECO:0000250|UniProtKB:O14965; propagated from
                     UniProtKB/Swiss-Prot (A5GFW1.1); phosphorylation site"
     misc_feature    871..873
                     /gene="AURKA"
                     /gene_synonym="ARK-1; STK6"
                     /note="Phosphothreonine.
                     /evidence=ECO:0000250|UniProtKB:O14965; propagated from
                     UniProtKB/Swiss-Prot (A5GFW1.1); phosphorylation site"
     misc_feature    1033..1035
                     /gene="AURKA"
                     /gene_synonym="ARK-1; STK6"
                     /note="Phosphoserine, by PKA and PAK.
                     /evidence=ECO:0000250|UniProtKB:O14965; propagated from
                     UniProtKB/Swiss-Prot (A5GFW1.1); phosphorylation site"
     exon            1..39
                     /gene="AURKA"
                     /gene_synonym="ARK-1; STK6"
                     /inference="alignment:Splign:2.1.0"
     exon            40..319
                     /gene="AURKA"
                     /gene_synonym="ARK-1; STK6"
                     /inference="alignment:Splign:2.1.0"
     exon            320..374
                     /gene="AURKA"
                     /gene_synonym="ARK-1; STK6"
                     /inference="alignment:Splign:2.1.0"
     exon            375..566
                     /gene="AURKA"
                     /gene_synonym="ARK-1; STK6"
                     /inference="alignment:Splign:2.1.0"
     exon            567..714
                     /gene="AURKA"
                     /gene_synonym="ARK-1; STK6"
                     /inference="alignment:Splign:2.1.0"
     exon            715..863
                     /gene="AURKA"
                     /gene_synonym="ARK-1; STK6"
                     /inference="alignment:Splign:2.1.0"
     exon            864..1038
                     /gene="AURKA"
                     /gene_synonym="ARK-1; STK6"
                     /inference="alignment:Splign:2.1.0"
     exon            1039..1218
                     /gene="AURKA"
                     /gene_synonym="ARK-1; STK6"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

atggacaaatgtaaagaaaactgcatttcggggcttaagaccacagttccacctggcgatggtccaaaacgggttccagtgacccagcactttccagctcagcatctgccgtctgcaaacagcggccaggcccagcgggtcttatgtccttcgaattcctcacagcgcctgccttcgcacacgcagaagctcgtctccagccataaaccagttcagaatctgaagcagaagcagtcgcaggcaaccagtggccctcgtcctgtctccaggcctctgagtaacacccagcagagtgagcagccccagccggcagcgcctggaaacaatcctgaaaaggaagcggcatcaaaacagaaaaatgaagaatcaaaaaaaaggcaatgggctttggaagattttgaaattggccgcccgctgggtaaaggaaagtttggtaatgtttatttagcaagagaaaaacaaagcaagtttatcctggctcttaaagtattgtttaaaactcagctggagaaggcaggagttgagcatcagctgagaagagaagtagaaatacagtcccaccttaggcatccaaatattctcagactgtatggttatttccatgacgctaccagagtttacctaatcctggaatacgcacctctcggagctgtctatagagaacttagagaacttcagaaactgtcaaagtttgatgagcagagaactgctacttatatcacagaattggcaaatgccctatcttactgtcactcaaagagagttattcacagagacattaagccagagaacctgctccttggatccgctggagagcttaagattgccgattttgggtggtcggtccatgccccgtcctccaggagaaccaccctctgcggcaccctggactacttgccccccgagatgatcgaaggccggatgcatgacgagaaggtggatctctggagcttgggggtgctttgctatgaattcctggttgggaagcccccctttgaggcaaacacgtaccaagagacctacaaaaggatatcccgggtggaattcaccttccctgactttgcgcccgagggagccagggacctcatctcaagactattgaagcacaaccccagccacaggcccaccctcaaggaggtgctcgaacacccctggatcaccgccaattccaagccagcaagtagtcacaaaaaagaatccaccagcaagcaaccctaa

//