LOCUS       NM_001025223             936 bp    mRNA    linear   MAM 18-FEB-2022
DEFINITION  Sus scrofa speedy/RINGO cell cycle regulator family member A
            (SPDYA), mRNA.
ACCESSION   NM_001025223
VERSION     NM_001025223.1
KEYWORDS    RefSeq.
SOURCE      Sus scrofa (pig)
  ORGANISM  Sus scrofa
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Suina; Suidae;
            Sus.
REFERENCE   1  (bases 1 to 936)
  AUTHORS   Kume S, Endo T, Nishimura Y, Kano K and Naito K.
  TITLE     Porcine SPDYA2 (RINGO A2) stimulates CDC2 activity and accelerates
            meiotic maturation of porcine oocytes
  JOURNAL   Biol. Reprod. 76 (3), 440-447 (2007)
   PUBMED   17151349
  REMARK    GeneRIF: pig SPDYA2 has important role in meiotic maturation of
            porcine oocytes and the rapid degradation of SPDY was necessary for
            the normal maturation of oocytes.
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AB196772.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AB196772.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN03031526, SAMN04484993
                                           [ECO:0000348]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..936
                     /organism="Sus scrofa"
                     /mol_type="mRNA"
                     /db_xref="taxon:9823"
                     /chromosome="3"
                     /map="3"
     gene            1..936
                     /gene="SPDYA"
                     /gene_synonym="RINGO; SPDY1"
                     /note="speedy/RINGO cell cycle regulator family member A"
                     /db_xref="GeneID:574061"
                     /db_xref="VGNC:VGNC:93396"
     CDS             1..936
                     /gene="SPDYA"
                     /gene_synonym="RINGO; SPDY1"
                     /note="rapid inducer of G2/M progression in oocytes;
                     speedy homolog 1; speedy homolog A"
                     /codon_start=1
                     /product="speedy protein A"
                     /protein_id="NP_001020394.1"
                     /db_xref="GeneID:574061"
                     /db_xref="VGNC:VGNC:93396"
                     /translation="

MRHNQLCCETPPTVTVHVRSGSNRSHQPKKPINLKRPIFKDSWPASEKNAHNSNKSKRPKGPCLVIQRQEMTAFFKLFDDDLIQDFLWMDCCCKIADKYLLAMTFVYFKRAKFTINEHTRINFFIALYLANTVEEDEEESKYEIFPWALGKNWRKLFPDFLKLRDQLWDRIDYRAIVSRRCCEEVMAIAPTHYIWQRERSVHHSGAVRNYNRDEVQLPRGPSATPVDCSLCGKKGRYVRLGLSSSSSSSDTVEVVEKQSQESHNSFSMDIIVDPSQAYSYPQANDHQSNKEKKTNFMKKDKSMEWFTGSEE"

     misc_feature    205..597
                     /gene="SPDYA"
                     /gene_synonym="RINGO; SPDY1"
                     /note="Cell cycle regulatory protein; Region: Spy1;
                     pfam11357"
                     /db_xref="CDD:463263"
     exon            1..235
                     /gene="SPDYA"
                     /gene_synonym="RINGO; SPDY1"
                     /inference="alignment:Splign:2.1.0"
     exon            236..294
                     /gene="SPDYA"
                     /gene_synonym="RINGO; SPDY1"
                     /inference="alignment:Splign:2.1.0"
     exon            295..380
                     /gene="SPDYA"
                     /gene_synonym="RINGO; SPDY1"
                     /inference="alignment:Splign:2.1.0"
     exon            381..552
                     /gene="SPDYA"
                     /gene_synonym="RINGO; SPDY1"
                     /inference="alignment:Splign:2.1.0"
     exon            553..847
                     /gene="SPDYA"
                     /gene_synonym="RINGO; SPDY1"
                     /inference="alignment:Splign:2.1.0"
     exon            848..936
                     /gene="SPDYA"
                     /gene_synonym="RINGO; SPDY1"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

atgagacataatcagctgtgttgcgagacaccacctactgtcactgtacatgtaagatcagggtcaaatagatcacatcagcccaaaaaacccattaatctgaagcgtcctatttttaaagatagttggccagcatctgaaaaaaatgcacataatagcaacaagtctaaacgccccaaaggaccctgtctagttatacagcgtcaggaaatgactgctttctttaaattatttgatgatgatttaattcaagatttcttgtggatggactgctgctgtaaaattgcagacaagtatcttttagctatgacctttgtttatttcaagagagccaaatttactataaacgagcataccaggataaatttctttattgctctgtatctggctaatacagttgaagaagatgaagaagaatccaaatatgaaatttttccatgggctttagggaaaaactggagaaaattattccctgatttcttaaagttaagggaccaactctgggatagaattgactatagagctattgtaagcaggcgatgctgtgaggaggttatggccattgctccaacacattatatatggcaacgagaacgctctgtgcatcacagtggagctgttagaaactacaacagagatgaagttcaattgccccggggacctagtgccacgccagtagattgttcactctgtggtaaaaaaggaagatatgttagactgggattgtcttcatcatcttcatccagcgatacagtagaggtggtggagaaacagtctcaagaatcacacaattcattctcaatggacataatagttgatccttctcaagcttatagctatcctcaagccaatgaccatcaatcaaacaaagaaaagaaaactaatttcatgaagaaagacaaatctatggagtggtttacaggaagtgaagaatga

//