GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-04-19 10:40:42, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       XM_018090379            4136 bp    mRNA    linear   VRT 18-DEC-2019
DEFINITION  PREDICTED: Xenopus tropicalis piwi-like RNA-mediated gene silencing
            1 (piwil1), transcript variant X2, mRNA.
ACCESSION   XM_018090379
VERSION     XM_018090379.2
DBLINK      BioProject: PRJNA205740
KEYWORDS    RefSeq.
SOURCE      Xenopus tropicalis (tropical clawed frog)
  ORGANISM  Xenopus tropicalis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Amphibia; Batrachia; Anura; Pipoidea; Pipidae; Xenopodinae;
            Xenopus; Silurana.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_030677.2) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Dec 18, 2019 this sequence version replaced XM_018090379.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Xenopus tropicalis Annotation
                                           Release 104
            Annotation Version          :: 104
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.3
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4136
                     /organism="Xenopus tropicalis"
                     /mol_type="mRNA"
                     /strain="Nigerian"
                     /db_xref="taxon:8364"
                     /chromosome="1"
                     /sex="female"
                     /tissue_type="liver and blood"
                     /dev_stage="adult"
                     /note="F17 inbred"
     gene            1..4136
                     /gene="piwil1"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 45 ESTs, 2 Proteins, and 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 7 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:100488735"
                     /db_xref="Xenbase:XB-GENE-963233"
     CDS             204..2663
                     /gene="piwil1"
                     /codon_start=1
                     /product="piwi-like protein 1 isoform X2"
                     /protein_id="XP_017945868.1"
                     /db_xref="GeneID:100488735"
                     /db_xref="Xenbase:XB-GENE-963233"
                     /translation="
MSGRARARARGRARGQEPPAPGKEPQPGYTQKTSTEEQAEPEIVGRGRQKRASVAHSTPVTQAGDLQISAGFQEISLGDRGGRRRDFHDLGINTRQAIEHVKESKTGSSGSIIQLSTNHIKLISRPQWVLFQYHIDYAPQMESRGLRCALLFQHEELIGKARAFDGTMLFLPKRLDKVNEVFSQTRNGETVKITITLTNELPPTSPTCFQFYNIIFRRLLKMMNMKQIGRNYYNPNDQIEISSHGLTIYPGFSTSILQYENNIMLSIDVSHKVLRSETVLDYMYNVNQKVESHKFHDICSKDLIGQIVLTKYNNKTYRIDDINWDFTPESTFKKSDGSEISFVDYYRTQYNKGITDLNQPALVHNPKKPRGPQNVPAGPILLIPEFCFLTGLTDRMRSDFNVMKDLAIHTRLAPEQREIQVGKFLKNIHKDDSVQKELQDWGLNFDSKLLPFAGRVAPAEKILQAGKTADYNPQFADWSRELRGPTLIRVKHLDNWVLLYTRRNYDAANTLTQNLFKVSGQMGIKMNRAVMVEVDDTTDAYVKVLQQKVTPDVQMVVCLLSSNRKDKYDAIKKYLCIDCPVPSQCVLAKTLNKPQTVVSVATKIALQMNCKMGGELWTVEIPLKELMIVGIDCYHDTLSGKRSIGAFVASLNPSMTRWFSRCVLQAQKQEIVDGLKVCMHAALKAWFNCNKSLPSRIIIYRDGVGDGQLKTMVEYEIPQLQDCIRSAEKDYRYDFFIISQSVRVGSVSPTHYNVVYDSGALKPDHMQRLTYKLCHLYYNWPGVIRVPAPCQYAHKLAFLVGQSIHREPHLTLSDRLYYL"
     misc_feature    249..524
                     /gene="piwil1"
                     /note="GAGE protein; Region: GAGE; pfam05831"
                     /db_xref="CDD:461753"
     misc_feature    1029..1382
                     /gene="piwil1"
                     /note="PAZ domain, Piwi_like subfamily. In multi-cellular
                     organisms, the Piwi protein appears to be essential for
                     the maintenance of germline stem cells. In the Drosophila
                     male germline, Piwi was shown to be involved in the
                     silencing of retrotransposons in the...; Region:
                     PAZ_piwi_like; cd02845"
                     /db_xref="CDD:239211"
     misc_feature    order(1164..1166,1203..1205,1227..1229,1239..1241,
                     1293..1295,1341..1343,1347..1349)
                     /gene="piwil1"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239211"
     misc_feature    1404..2609
                     /gene="piwil1"
                     /note="PIWI domain, Piwi-like subfamily found in
                     eukaryotes. This domain is found in Piwi and closely
                     related proteins, where it is believed to perform a
                     crucial role in germline cells, via RNA silencing. RNA
                     silencing refers to a group of related...; Region:
                     Piwi_piwi-like_Euk; cd04658"
                     /db_xref="CDD:240016"
     misc_feature    order(1905..1907,1917..1919,1953..1964,1971..1973,
                     2001..2003,2010..2012,2022..2024,2034..2036)
                     /gene="piwil1"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240016"
     misc_feature    order(2097..2099,2103..2105,2307..2309,2583..2585)
                     /gene="piwil1"
                     /note="active site"
                     /db_xref="CDD:240016"
ORIGIN      
gtggggcgtagccttagggaattatagtttgtggcgcagcaagaaattggatctgtactgcgcggatgaatttttcgcgggtctgcgctgaagtgaaggggccttagttcagtgacagagacgagcggcggcgcaacttttcctcacctgttgactcgcgttagaataaagggagcctgtttgtcttggacaaggagataaaaatgtcaggaagagctagagcaagagctcgaggcagagcccgtggtcaggaaccaccagcacctggaaaggagcctcaacctggatatacacaaaagacatcaacagaagagcaagcagaaccagagattgttgggcgtggacgtcagaagagagcctctgttgctcactcaactccagtgacacaggcaggagacctgcagatatcagcaggatttcaagaaatatctcttggggatcgtggtggacgtagacgtgattttcatgaccttggtataaatactcgtcaagcaatagaacacgtcaaagagtcaaaaacaggttcttctggaagcataattcagctaagtacaaaccatataaaacttatctctagacctcagtgggtattattccaatatcatattgactatgccccacagatggaatctaggggattgcgctgtgctttactctttcagcatgaggaacttattggaaaagcacgtgcttttgatggaacaatgttatttttacctaaaagacttgataaggttaatgaggtttttagtcaaacccgcaatggtgagacagtgaagatcactattactttaacaaacgagttaccacctacttcaccaacgtgcttccagttctacaacatcatttttcgaagacttctgaagatgatgaatatgaagcagattggacgtaattactacaatcctaatgatcagatagaaattagttcacatggccttactatatatccagggttttccacttcaattctgcaatatgaaaacaacataatgttaagcatagatgtgagccacaaagttttaagaagcgaaacagttctggattacatgtacaatgtgaaccaaaaagtggagtcacataaattccatgatatctgcagcaaagacctgattggacaaattgttcttacaaagtacaacaataagacttaccggattgatgatatcaactgggattttactccagagtctacatttaagaaatcagatggttcagaaataagctttgttgattactatagaacacaatataataaaggaatcacagacttaaaccagcctgctcttgttcataatccaaaaaaacccaggggtccacagaatgttccagcaggaccaattctcttgataccagaattttgtttcctaacaggtttaactgatcgaatgaggagtgattttaatgtaatgaaggacctagcaattcataccagactggcaccagagcaaagagaaatacaagttggaaaatttctaaagaatattcacaaggatgatagtgtgcagaaagagcttcaggattggggcttaaactttgactcaaaacttttgccttttgctggcagagtagctccagcagagaagattttgcaggctggaaaaacagctgactacaatcctcagtttgctgactggtcaagagaattacgaggaccgacactaatccgtgtgaaacatttggataattgggtattgttatacacacgcagaaactatgatgctgccaatactttgacacaaaatctgttcaaagtgtcaggtcaaatgggaatcaagatgaatagagcagtaatggtggaagtagatgacactacagatgcatatgtaaaagttttgcagcaaaaggtaacacctgatgtacagatggtagtttgtcttctctctagtaatcggaaggataaatatgatgctataaaaaaatacctgtgcattgactgcccagttccaagtcaatgcgtgttagcaaagactttaaataaaccacagaccgttgtttcagttgcaacaaaaattgcattacagatgaactgcaagatggggggagagttatggactgttgaaatacctctgaaggaattgatgattgttggcattgattgttatcacgacacattatcaggaaaaagatctattggggcatttgttgccagtttaaacccaagcatgacacggtggttttctcgttgtgttctccaggcacagaaacaagagattgttgatggtctcaaagtctgcatgcatgctgccctaaaagcctggtttaattgcaacaaaagtctgccttcccgtataataatctaccgagatggagtaggagatggtcagttgaaaacaatggtcgaatacgaaataccacagctccaggattgtataaggtctgctgaaaaagattacaggtatgacttcttcataatcagccagtctgtaagagtaggttctgtgtcgccaactcactacaacgttgtgtatgacagcggcgcattgaaaccagatcatatgcaaagactgacttacaagctttgccatctgtactacaactggccaggtgtaatcagagtgccagctccttgtcagtatgcccataaattagcatttttggttggtcagagcatccacagagaaccacatcttacactttcggatcgcctatattatctctaagttttttggggaacggccaattgagttttctgccgcttcagtctaaaagtactctacttaatttagttagtttaaatttgtgtaccaggagttaatttactgttaatctgaaaaagcattgttaattggataaaacctacctttattttccatattgtaaccaattaaaaaaaaaaggattttctttggatatttagcttacattccagtaggttactgctctataaagtatatctgttctattacttgacacttttgtattttcaaagcaaaattgagcctaacactatgtaacatttcatccatttcagttatcagacctgctgagaggttatcagcatgatgaactgacaatataccagttatcttactttttctaaacagcattgttcaagcattactagaagagtaaatacaacataagctgaaactaattttatttacaaagttagtcgccttcaattattcataacaacactattcaatatataatggttggattagagttggatataatttaaatattgttcactcaccttagcatggatttgaaatcccatctatggtttcaaaaaaatgaaaccataagcatcttaagttggtgcattcagatgagaaataatatttatttagaaagcaatcattgtaataatggatgtttggtttgggtatcacatggtaaatttggttcaaacccaaatagtttagcccagtgggcccttcctcttttggtagaacttcagtctaggttggtattggttcattgaatgtgacagccagactaaaagaaatactgccacttaaacaagaaaagccaatataatagcaataaaataggcaaacacagtgcttgagggttttaaacatgcagagtgttgtggctaacaaatctccagaaagtaaatatgtattcatgccatgcagcctaaaaaaaatgtccaaattgggacactctagctgtagcaacaggacattcatgaacaaacatggggccatatattacttttaagttaatgttgtttctgtgactatatatgctaaaacattttaatcactgaactaagcttggaaatgtgtggagaaaaataaaactacataagtattgatctctaaataattattggaggctcattgtagacatttaaatatacagtatcattcaaaggcatttggtaaggatttaattaggtaatataagacaaaatgtttggtttaagtattgtatgtctaagcctggaaacatgctttttagacagctgatttatgtttaggagtttgcaaactcatatggttttaagatcccatttacttacaggcgaaaacacatatgtatatctgttttcactagtgattactattgtaaaagttatttttgttaatgtcaaaactactattacaggtgcacacttaattgtgtattaattgcatttatatgaaaatggttacaataaagtttggattctaatatcatta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]