LOCUS       XM_012968458             865 bp    mRNA    linear   VRT 18-DEC-2019
DEFINITION  PREDICTED: Xenopus tropicalis ribosomal protein S5 (rps5),
            transcript variant X1, mRNA.
ACCESSION   XM_012968458
VERSION     XM_012968458.1
DBLINK      BioProject: PRJNA205740
KEYWORDS    RefSeq.
SOURCE      Xenopus tropicalis (tropical clawed frog)
  ORGANISM  Xenopus tropicalis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Amphibia; Batrachia; Anura; Pipoidea; Pipidae; Xenopodinae;
            Xenopus; Silurana.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_030684.2) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Xenopus tropicalis Annotation
                                           Release 104
            Annotation Version          :: 104
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.3
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..865
                     /organism="Xenopus tropicalis"
                     /mol_type="mRNA"
                     /strain="Nigerian"
                     /db_xref="taxon:8364"
                     /chromosome="8"
                     /sex="female"
                     /tissue_type="liver and blood"
                     /dev_stage="adult"
                     /note="F17 inbred"
     gene            1..865
                     /gene="rps5"
                     /note="ribosomal protein S5; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 6
                     mRNAs, 852 ESTs, 17 Proteins, and 100% coverage of the
                     annotated genomic feature by RNAseq alignments, including
                     129 samples with support for all annotated introns"
                     /db_xref="GeneID:549746"
                     /db_xref="Xenbase:XB-GENE-919703"
     CDS             198..809
                     /gene="rps5"
                     /codon_start=1
                     /product="40S ribosomal protein S5 isoform X1"
                     /protein_id="XP_012823912.1"
                     /db_xref="GeneID:549746"
                     /db_xref="Xenbase:XB-GENE-919703"
                     /translation="

MSDWETVPVGAETPEIKLFGKWSTDDVQINDISLQDYIAVKEKYAKFLPHSGGRYAAKRFRKAQCPIVERFTNSLMMHGRNNGKKLMTVRIVKHAFEIIHLLTGENPLQVLVNAIINSGPREDSTRIGRAGTVRRQAVDVSPLRRVNQAIWLLCTGAREAAFRNIKTIAECVADELINAAKGSSNSYAIKKKDELERVAKSNR"

     misc_feature    246..806
                     /gene="rps5"
                     /note="Eukaryota homolog of Ribosomal Protein S7; Region:
                     uS7_Eukaryote; cd14867"
                     /db_xref="CDD:271246"
     misc_feature    order(246..248,333..341,345..356,453..455,465..467)
                     /gene="rps5"
                     /note="S9 interface [polypeptide binding]; other site"
                     /db_xref="CDD:271246"
     misc_feature    order(345..347,351..353,363..374,381..383,405..407,
                     414..416,420..434,444..458,465..467,585..593,597..599,
                     627..629,648..650,669..671,678..680,696..701)
                     /gene="rps5"
                     /note="rRNA binding site [nucleotide binding]; other site"
                     /db_xref="CDD:271246"
     misc_feature    order(477..479,486..491,498..500,696..698,702..707)
                     /gene="rps5"
                     /note="S25 interface [polypeptide binding]; other site"
                     /db_xref="CDD:271246"
     misc_feature    order(582..584,591..593,597..599,804..806)
                     /gene="rps5"
                     /note="S11 interface [polypeptide binding]; other site"
                     /db_xref="CDD:271246"
ORIGIN      

ttcacggaagtgacgctcatagcatgccatgatgaatatggcgctttttgcttcagttcgtttgcgggtagttatcagcaagtaagggcagaagcctaagaggaagtgtgggcccctgtataactgggttggagaccccgccccggcctctttccgctccgagctccgaccggttaagacacagccgaggagacacgatgtcagattgggagaccgttccagttggggctgagacccctgaaattaaactgtttggaaaatggagcacagatgatgtacaaataaatgatatttctctacaggattacattgcagtgaaggaaaaatatgccaagttcctgccacacagcggaggacgttatgctgcaaaacgcttccgtaaggctcagtgccccattgtggaacgtttcaccaactcccttatgatgcatgggaggaacaatggcaaaaaactcatgacagtcagaattgtaaagcatgcctttgaaatcatccacctgctaaccggggagaatcccctgcaagttttggtaaatgccatcatcaacagtggtcctagggaagattctacacgtattggtagagctggaactgtgaggagacaagctgttgacgtttcacctcttaggagagtaaaccaggctatatggctgctttgcactggggcccgtgaagctgcttttaggaacattaagacaattgcagagtgcgttgctgatgaacttattaatgcagccaagggttcctctaactcatatgccatcaagaaaaaggatgaactggagagagtagccaaatccaaccgttaaagcatcagcagtttaatgagagtatacgttctcataataaagaaatttgttctgta

//