LOCUS       XM_012958498            3223 bp    mRNA    linear   VRT 18-DEC-2019
DEFINITION  PREDICTED: Xenopus tropicalis piwi-like RNA-mediated gene silencing
            2 (piwil2), transcript variant X1, mRNA.
ACCESSION   XM_012958498
VERSION     XM_012958498.3
DBLINK      BioProject: PRJNA205740
KEYWORDS    RefSeq.
SOURCE      Xenopus tropicalis (tropical clawed frog)
  ORGANISM  Xenopus tropicalis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Amphibia; Batrachia; Anura; Pipoidea; Pipidae; Xenopodinae;
            Xenopus; Silurana.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_030679.2) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Dec 18, 2019 this sequence version replaced XM_012958498.2.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Xenopus tropicalis Annotation
                                           Release 104
            Annotation Version          :: 104
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.3
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3223
                     /organism="Xenopus tropicalis"
                     /mol_type="mRNA"
                     /strain="Nigerian"
                     /db_xref="taxon:8364"
                     /chromosome="3"
                     /sex="female"
                     /tissue_type="liver and blood"
                     /dev_stage="adult"
                     /note="F17 inbred"
     gene            1..3223
                     /gene="piwil2"
                     /gene_synonym="ct80; hili; mili; piwil1l; xili"
                     /note="piwi-like RNA-mediated gene silencing 2; Derived by
                     automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 27 ESTs, 4 Proteins, and 100% coverage of the
                     annotated genomic feature by RNAseq alignments, including
                     12 samples with support for all annotated introns"
                     /db_xref="GeneID:100127654"
                     /db_xref="Xenbase:XB-GENE-982236"
     CDS             58..2940
                     /gene="piwil2"
                     /gene_synonym="ct80; hili; mili; piwil1l; xili"
                     /codon_start=1
                     /product="piwi-like protein 2 isoform X1"
                     /protein_id="XP_012813952.1"
                     /db_xref="GeneID:100127654"
                     /db_xref="Xenbase:XB-GENE-982236"
                     /translation="

MGSQQRVTAQKMDPTRPPFRGSPFHTPLGVRPPVLETKEEGPHGRAVLLPRGRALLGASAPSSDTTQRDPSDSRNVLPALFRGMGIETKPSGIPGRGGPVFGRGFLSTMSSGDGPDQPLSEPSIRPSLSTRVQQASDFSTERVALGRARFPIPPVSMEKPHVPTGRGLLFPSVLPTLTSDPVPKESPIATLQIEKEEKWEPLPKKGSKGSPCQLGLNLIKINFQNEAVYQYHVTFTPIVECRSMRFGMMKDHRSVTGPVTAFDGSILYLPVKLAQTVELESERRTDGQKIKITIQMTKILDPSSDLCLPFYNVVMRRVFKILDLKLVGRNFYDPASSTVLQQYRLQVWPGYAANIRKTDGGLFLLVDITHKIIRSDSVLDIMNILYQQSPENFQDEVTKQLVGSIVITRYNNRTYRIDDIEWNMSPKDSFSMSDGSKVSFIDYYSKNYGITVKELDQPLLLHRPSERKAPKGKALDIVLLLPELAFMTGIPEKMRKDFRAMKDLTQQIHLSPKQHHISLGKLLKRIESSADAKNELQRWGLFLDTDIHMTTGRILPIEKINLRNNSFPAGEDLNWNREVTREACRSSVHLLYWAMIYPKRASAQAQELSSMLERIGGPIGIRVNHPNCVELRDDRVETYARSIKSLLEGEGKVQLLVCLISGTRDDLYGAIKKLCCVQNPVPSQVINTRTISQPQKLRSIAQKILLQINCKLGGELWGVDIPLKSVMVIGMDVYHDPSRGMRSVLGFVASINSCLTAWYSRVVFQLPNQEIMDSLKLCLVAALQKFFEVNHSLPEKIVVYRDGVSDGQLNTVENYEIPQLQTCFQTFDNYNPRMVVIVVQKRVSTNLYSTATGQFLTPQPGTVIDHTVTNRKWIDFFLMSHHVRQGCGIPTHYICVMNTANLGPDHLQRLTFKLCHMYWNWPGTIRVPAPCKYAHKLAFLSGQFLHHEPSIKLCDKLFFL"

     misc_feature    <76..627
                     /gene="piwil2"
                     /gene_synonym="ct80; hili; mili; piwil1l; xili"
                     /note="large tegument protein UL36; Provisional; Region:
                     PHA03247"
                     /db_xref="CDD:223021"
     misc_feature    1036..1179
                     /gene="piwil2"
                     /gene_synonym="ct80; hili; mili; piwil1l; xili"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:462567"
     misc_feature    1183..1596
                     /gene="piwil2"
                     /gene_synonym="ct80; hili; mili; piwil1l; xili"
                     /note="This domain is named PAZ after the proteins Piwi
                     Argonaut and Zwille; Region: PAZ; smart00949"
                     /db_xref="CDD:198017"
     misc_feature    order(1312..1314,1351..1353,1375..1377,1387..1389,
                     1441..1443,1486..1488,1495..1497)
                     /gene="piwil2"
                     /gene_synonym="ct80; hili; mili; piwil1l; xili"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239211"
     misc_feature    1552..2886
                     /gene="piwil2"
                     /gene_synonym="ct80; hili; mili; piwil1l; xili"
                     /note="PIWI domain, Piwi-like subfamily found in
                     eukaryotes. This domain is found in Piwi and closely
                     related proteins, where it is believed to perform a
                     crucial role in germline cells, via RNA silencing. RNA
                     silencing refers to a group of related...; Region:
                     Piwi_piwi-like_Euk; cd04658"
                     /db_xref="CDD:240016"
     misc_feature    order(2059..2061,2071..2073,2107..2118,2125..2127,
                     2155..2157,2164..2166,2176..2178,2188..2190)
                     /gene="piwil2"
                     /gene_synonym="ct80; hili; mili; piwil1l; xili"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240016"
     misc_feature    order(2251..2253,2257..2259,2461..2463,2860..2862)
                     /gene="piwil2"
                     /gene_synonym="ct80; hili; mili; piwil1l; xili"
                     /note="active site"
                     /db_xref="CDD:240016"
ORIGIN      

acgcccccgaggaccaatcgggagcgcagtaagcgcgacagacagaatgctcggccaatgggaagtcagcagcgggttaccgcccaaaaaatggatcctaccagacctccattcaggggttccccctttcatacaccattgggagtgcgtcctccagttctagaaactaaagaagaagggccacatggaagagcagtcctattaccacggggccgtgcattattgggtgcatcagcaccttcttctgatactacccaaagagatccatctgactctaggaatgttctccctgctctatttcgtggtatgggaattgaaacaaagcccagtgggattcctggccgtggtgggccagtctttggcagggggtttctttctactatgtcttcaggagatggccctgatcagccactttcagaaccctctataagaccctccctctcaacccgtgttcagcaagcaagtgattttagcacagagagggttgcacttgggagagccaggtttccaatacctccggtgagtatggaaaagccacatgtacccactggaaggggtttgttatttccctctgttctacccactttgacatctgacccagtacctaaagaaagccctatcgctacacttcaaattgagaaggaagagaaatgggagcctttaccaaagaaaggcagcaaaggtagcccctgtcagcttggactgaacctcattaaaattaacttccagaatgaagccgtatatcagtaccatgtcacatttactcccatagtggagtgccgtagtatgcgttttggtatgatgaaggaccaccgctctgtgacaggaccagtaactgcattcgacggttctatactttaccttcctgtcaaacttgcacagacagttgagctggagagtgaacgccggacagatggacaaaaaataaagataaccatacagatgacaaagattctggatcccagttcagacttgtgccttcctttttataatgtagtcatgaggagggtgttcaaaattctggacctgaaacttgttgggagaaatttttatgacccagcaagttcaacagtgctgcagcagtacagactgcaggtgtggccaggctatgctgcaaatatacgcaaaactgacggtgggctatttcttttggttgacatcacccacaagattatccgcagtgattctgtgctggacatcatgaacattctatatcagcagagccctgagaactttcaggatgaggttaccaagcagctggttggcagcattgtgatcaccagatacaacaaccgtacctaccgaatagatgacattgaatggaacatgagccccaaggactccttctctatgtcagatggaagcaaagtcagtttcattgattattacagcaagaactatggcataactgttaaggagctggaccaacccttgctgcttcacagacctagtgaaaggaaggcaccaaagggcaaggcacttgatattgtcctcctcttaccagaacttgcttttatgactggcatccctgaaaaaatgagaaaagactttcgggccatgaaggatctgacacagcagattcatttaagcccaaaacagcatcatatctctttggggaaattgctaaaacgtattgaaagcagtgcggatgcaaagaatgaactgcagcgttggggcttattcctagacactgatattcacatgaccactggtaggattttaccaatagagaaaataaatctgcgtaataactcatttcctgcaggagaagatctcaattggaacagggaagtgacacgtgaggcatgccgttcctcagtgcatcttctttattgggcaatgatatatcctaaacgggcttcagcacaggcacaagaattgtctagtatgctggagaggattggaggacctattggaatacgagtaaaccatcctaactgtgtggagctccgggatgaccgtgtcgaaacgtacgcgcgcagcatcaaatcactgttagagggtgagggcaaagttcagctactagtgtgtcttatatctgggaccagagatgacctgtacggtgctattaagaaattgtgttgtgtacagaacccagttccatcacaggtgattaataccagaaccatctcccagccccagaagctcaggagcattgcacagaaaattctgcttcagattaactgcaagctgggaggggaactgtggggagtagacatccctctgaaaagtgtgatggtgattgggatggatgtttatcacgaccccagcagaggcatgcgctctgtattaggctttgttgctagcatcaacagctgcctgactgcttggtattctcgtgtggtctttcagcttcctaaccaggagatcatggatagcctaaagctttgccttgtggcagccctgcagaaattctttgaggtgaatcacagtcttccagagaagattgtggtgtatcgagatggcgtatctgatgggcaacttaacacggtggaaaactatgagatcccacagcttcaaacttgcttccagacatttgataactataatccacgtatggtggttattgtagtacagaaaagggttagcactaatctgtactctaccgccactgggcagtttcttacccctcaacctgggactgttatagaccatacagtcaccaaccgcaagtggatagatttcttcctgatgtctcatcatgtgagacaaggctgcgggatccccacccactacatttgtgtcatgaatacagcaaatttgggtcctgaccatttacagaggttgaccttcaagctttgccacatgtactggaactggcctgggaccatccgagtgccagctccatgtaaatacgcacacaagctggccttcctttccggtcagtttctgcaccacgagccttccataaagctgtgtgacaagcttttcttcctttgaaacagagtcacaaatggagcccaatacaaaaaaaaagaaaatcctttaggataaaattgctctatccctttttattgtttctgtttaagtatcttccttttagtttttatccctctttcttccatatcatgcccattacttcttctccaaccatttagcttagataccatttcattttaggacaagctgttcagttttatttgttgttaagaggacaagaaatgtatcacatgcctttaatatgttccatctgaaaaagaacaagattttgacccggttaaaa

//