GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-04-17 02:03:31, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       NM_001182305            1701 bp    mRNA    linear   PLN 17-DEC-2024
DEFINITION  Saccharomyces cerevisiae S288C ESCRT-II subunit protein VPS36
            (VPS36), partial mRNA.
ACCESSION   NM_001182305
VERSION     NM_001182305.3
DBLINK      BioProject: PRJNA128
KEYWORDS    RefSeq.
SOURCE      Saccharomyces cerevisiae S288C
  ORGANISM  Saccharomyces cerevisiae S288C
            Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina;
            Saccharomycetes; Saccharomycetales; Saccharomycetaceae;
            Saccharomyces.
REFERENCE   1  (bases 1 to 1701)
  AUTHORS   Engel,S.R., Wong,E.D., Nash,R.S., Aleksander,S., Alexander,M.,
            Douglass,E., Karra,K., Miyasato,S.R., Simison,M., Skrzypek,M.S.,
            Weng,S. and Cherry,J.M.
  TITLE     New data and collaborations at the Saccharomyces Genome Database:
            updated reference genome, alleles, and the Alliance of Genome
            Resources
  JOURNAL   Genetics 220 (4) (2022)
   PUBMED   34897464
REFERENCE   2  (bases 1 to 1701)
  AUTHORS   Johnston,M., Hillier,L., Riles,L., Albermann,K., Andre,B.,
            Ansorge,W., Benes,V., Bruckner,M., Delius,H., Dubois,E.,
            Dusterhoft,A., Entian,K.D., Floeth,M., Goffeau,A., Hebling,U.,
            Heumann,K., Heuss-Neitzel,D., Hilbert,H., Hilger,F., Kleine,K.,
            Kotter,P., Louis,E.J., Messenguy,F., Mewes,H.W., Hoheisel,J.D. et
            al.
  TITLE     The nucleotide sequence of Saccharomyces cerevisiae chromosome XII
  JOURNAL   Nature 387 (6632 SUPPL), 87-90 (1997)
   PUBMED   9169871
REFERENCE   3  (bases 1 to 1701)
  AUTHORS   Goffeau,A., Barrell,B.G., Bussey,H., Davis,R.W., Dujon,B.,
            Feldmann,H., Galibert,F., Hoheisel,J.D., Jacq,C., Johnston,M.,
            Louis,E.J., Mewes,H.W., Murakami,Y., Philippsen,P., Tettelin,H. and
            Oliver,S.G.
  TITLE     Life with 6000 genes
  JOURNAL   Science 274 (5287), 546 (1996)
   PUBMED   8849441
REFERENCE   4  (bases 1 to 1701)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (17-DEC-2024) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   5  (bases 1 to 1701)
  CONSRTM   Saccharomyces Genome Database
  TITLE     Direct Submission
  JOURNAL   Submitted (16-JAN-2015) Department of Genetics, Stanford
            University, Stanford, CA, USA
  REMARK    Protein update by submitter
REFERENCE   6  (bases 1 to 1701)
  CONSRTM   Saccharomyces Genome Database
  TITLE     Direct Submission
  JOURNAL   Submitted (06-FEB-2013) Department of Genetics, Stanford
            University, Stanford, CA, USA
  REMARK    Protein update by submitter
REFERENCE   7  (bases 1 to 1701)
  CONSRTM   Saccharomyces Genome Database
  TITLE     Direct Submission
  JOURNAL   Submitted (04-MAY-2012) Department of Genetics, Stanford
            University, Stanford, CA, USA
  REMARK    Protein update by submitter
REFERENCE   8  (bases 1 to 1701)
  CONSRTM   Saccharomyces Genome Database
  TITLE     Direct Submission
  JOURNAL   Submitted (31-MAR-2011) Department of Genetics, Stanford
            University, Stanford, CA, USA
  REMARK    Sequence update by submitter
REFERENCE   9  (bases 1 to 1701)
  CONSRTM   Saccharomyces Genome Database
  TITLE     Direct Submission
  JOURNAL   Submitted (14-DEC-2009) Department of Genetics, Stanford
            University, Stanford, CA, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by SGD. This record
            is derived from an annotated genomic sequence (NC_001144).
            
            On Jul 30, 2012 this sequence version replaced NM_001182305.2.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider :: SGD
            Annotation Status   :: Full Annotation
            Annotation Version  :: R64-4-1
            URL                 :: http://www.yeastgenome.org/
            ##Genome-Annotation-Data-END##
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..1701
                     /organism="Saccharomyces cerevisiae S288C"
                     /mol_type="mRNA"
                     /strain="S288C"
                     /db_xref="taxon:559292"
                     /chromosome="XII"
     gene            <1..>1701
                     /gene="VPS36"
                     /locus_tag="YLR417W"
                     /gene_synonym="GRD12; VAC3; VPL11"
                     /db_xref="GeneID:851135"
     CDS             1..1701
                     /gene="VPS36"
                     /locus_tag="YLR417W"
                     /gene_synonym="GRD12; VAC3; VPL11"
                     /experiment="EXISTENCE:direct assay:GO:0000814 ESCRT II
                     complex [PMID:12194858]"
                     /experiment="EXISTENCE:direct assay:GO:0043130 ubiquitin
                     binding [PMID:19380877|PMID:15029239]"
                     /experiment="EXISTENCE:mutant phenotype:GO:0000122
                     negative regulation of transcription by RNA polymerase II
                     [PMID:11278625]"
                     /experiment="EXISTENCE:mutant phenotype:GO:0006623 protein
                     targeting to vacuole [PMID:12194858]"
                     /experiment="EXISTENCE:mutant phenotype:GO:0016236
                     macroautophagy [PMID:17428789|PMID:19793921]"
                     /experiment="EXISTENCE:mutant phenotype:GO:0032258
                     cytoplasm to vacuole targeting by the Cvt pathway
                     [PMID:19793921]"
                     /experiment="EXISTENCE:mutant phenotype:GO:0045053 protein
                     retention in Golgi apparatus [PMID:8649377]"
                     /experiment="EXISTENCE:mutant phenotype:GO:1904669 ATP
                     export [PMID:26585826]"
                     /note="Component of ESCRT-II complex; contains GLUE (GRAM
                     Like Ubiquitin binding in EAP45) domain which is involved
                     in interactions with ESCRT-I and ubiquitin-dependent
                     sorting of proteins into endosome; plays role in lager
                     yeast flocculation under brewing conditions; plays role in
                     formation of mutant huntingtin (Htt) aggregates in yeast"
                     /codon_start=1
                     /product="ESCRT-II subunit protein VPS36"
                     /protein_id="NP_013521.3"
                     /db_xref="GeneID:851135"
                     /db_xref="SGD:S000004409"
                     /translation="
MEYWHYVETTSSGQPLLREGEKDIFIDQSVGLYHGKSKILQRQRGRIFLTSQRIIYIDDAKPTQNSLGLELDDLAYVNYSSGFLTRSPRLILFFKDPSSKDELGKSAETASADVVSTWVCPICMVSNETQGEFTKDTLPTPICINCGVPADYELTKSSINCSNAIDPNANPQNQFGVNSENICPACTFANHPQIGNCEICGHRLPNASKVRSKLNRLNFHDSRVHIELEKNSLARNKSSHSALSSSSSTGSSTEFVQLSFRKSDGVLFSQATERALENILTEKNKHIFNQNVVSVNGVDMRKGASSHEYNNEVPFIETKLSRIGISSLEKSRENQLLNNDILFNNALTDLNKLMSLATSIERLYKNSNITMKTKTLNLQDESTVNEPKTRRPLLILDREKFLNKELFLDEIAREIYEFTLSEFKDLNSDTNYMIITLVDLYAMYNKSMRIGTGLISPMEMREACERFEHLGLNELKLVKVNKRILCVTSEKFDVVKEKLVDLIGDNPGSDLLRLTQILSSNNSKSNWTLGILMEVLQNCVDEGDLLIDKQLSGIYYYKNSYWPSHI"
     misc_feature    10..366
                     /gene="VPS36"
                     /locus_tag="YLR417W"
                     /gene_synonym="GRD12; VAC3; VPL11"
                     /note="Pleckstrin homology-like domain or GLUE (GRAM-like
                     ubiquitin-binding in Eap45) domain of Vps36; Region:
                     PH-GRAM-like_Vps36; cd13227"
                     /db_xref="CDD:275409"
     misc_feature    order(112..114,256..258,265..267)
                     /gene="VPS36"
                     /locus_tag="YLR417W"
                     /gene_synonym="GRD12; VAC3; VPL11"
                     /note="phosphoinositide binding site [chemical binding];
                     other site"
                     /db_xref="CDD:275409"
     misc_feature    325..492
                     /gene="VPS36"
                     /locus_tag="YLR417W"
                     /gene_synonym="GRD12; VAC3; VPL11"
                     /note="Vacuolar protein sorting 36 NZF-N zinc-finger
                     domain; Region: Vps36-NZF-N; pfam16988"
                     /db_xref="CDD:407195"
     misc_feature    352..438
                     /gene="VPS36"
                     /locus_tag="YLR417W"
                     /gene_synonym="GRD12; VAC3; VPL11"
                     /note="RanBP2-type Zn finger [structural motif]; Region:
                     RanBP2-type Zn finger"
                     /db_xref="CDD:275376"
     misc_feature    535..609
                     /gene="VPS36"
                     /locus_tag="YLR417W"
                     /gene_synonym="GRD12; VAC3; VPL11"
                     /note="Zinc finger domain; Region: ZnF_RBZ; smart00547"
                     /db_xref="CDD:197784"
     misc_feature    541..600
                     /gene="VPS36"
                     /locus_tag="YLR417W"
                     /gene_synonym="GRD12; VAC3; VPL11"
                     /note="RanBP2-type Zn finger [structural motif]; Region:
                     RanBP2-type Zn finger"
                     /db_xref="CDD:275376"
     misc_feature    967..1644
                     /gene="VPS36"
                     /locus_tag="YLR417W"
                     /gene_synonym="GRD12; VAC3; VPL11"
                     /note="EAP30/Vps36 family; Region: EAP30; pfam04157"
                     /db_xref="CDD:461201"
ORIGIN      
atggagtactggcattatgtggaaactacgtcatcgggccaacctcttcttcgagaaggtgaaaaagatatctttatcgatcagtccgtaggtctttaccatggcaaatctaagattctacagcgacagaggggcagaatctttttaacgtcacaaagaattatctacatcgacgatgcaaagcccactcagaactcgcttgggttggaattggacgatctagcgtatgtaaactattcatctggcttcttgaccagatcacctcgtctgatcctgtttttcaaggacccctccagtaaggatgaacttggtaaaagtgcggaaacagcaagtgccgacgttgtttcgacgtgggtctgccccatctgtatggtttcgaacgaaacgcagggggaattcactaaagacactctacctacacccatttgtatcaattgcggtgtgccagcggactatgagctcaccaagtcgtctataaattgttctaatgcaatcgacccgaacgccaacccacagaatcagttcggagtgaactctgagaacatttgccccgcctgtacttttgctaatcatcctcaaataggaaattgcgagatttgcggccacagattgcctaatgcatccaaagtacgatcaaagctgaacaggctaaactttcatgattctagggtccatattgagctagaaaaaaattcactggctagaaacaagagctcgcactcggcattatcgtcctcgtcctcgacaggatcatcgacagaattcgtgcaattgagtttccgcaaatctgatggcgtattgttttcacaagctacagagagggctttggagaatatactcactgaaaagaataagcatattttcaatcagaatgtggtttctgtaaatggtgtagacatgaggaaaggggctagttctcacgaatacaacaatgaggtgccatttattgagactaaattgagcagaattggcatatcaagcttggaaaaatctagagaaaaccagcttttgaacaatgacattctctttaacaatgcgttgaccgacctaaacaagctaatgtcgctggctaccagcatcgaaagactatacaaaaatagcaacataacgatgaaaaccaagacattgaacttacaggatgaatcaaccgtgaatgaaccgaaaacgagaagaccgctattgatacttgatagagagaagttcctaaataaagagctgttcttggatgagattgcgagagaaatttacgagttcacgttgtccgagtttaaagatttgaacagtgataccaactatatgatcataactctggtagatctatatgcaatgtacaacaaatctatgcgtataggtacaggcctgatatctcccatggaaatgagagaagcatgcgaaagattcgagcatttaggtctaaatgaattgaagttagtgaaagttaacaaaagaatattatgtgtaacgagcgaaaaattcgacgttgtaaaagaaaagctagtagatctgatcggtgataatcctggttctgatctcctaagattgacacagattttgagttccaataattcaaaatcaaactggacgctaggtatccttatggaggtattacaaaattgtgtcgatgaaggcgatttactgatagacaagcaactgagtgggatttactactataaaaactcttattggccctcgcatatataa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]