LOCUS       NR_037360                111 bp    RNA     linear   ROD 20-FEB-2025
DEFINITION  Rattus norvegicus microRNA 1b (Mir1b), microRNA.
ACCESSION   NR_037360
VERSION     NR_037360.1
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 111)
  AUTHORS   Xie,Y., Tan,J., Qin,Y., Cao,Y., Wang,Y., Li,A., Wang,Z., Qiao,Z.
            and Yan,Z.
  TITLE     MiR-3571 modulates the proliferation and migration of vascular
            smooth muscle cells by targeting claudin 1
  JOURNAL   Int J Med Sci 19 (3), 511-524 (2022)
   PUBMED   35370461
  REMARK    GeneRIF: MiR-3571 modulates the proliferation and migration of
            vascular smooth muscle cells by targeting claudin 1.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 111)
  AUTHORS   Qian,L., Wythe,J.D., Liu,J., Cartry,J., Vogler,G., Mohapatra,B.,
            Otway,R.T., Huang,Y., King,I.N., Maillet,M., Zheng,Y., Crawley,T.,
            Taghli-Lamallem,O., Semsarian,C., Dunwoodie,S., Winlaw,D.,
            Harvey,R.P., Fatkin,D., Towbin,J.A., Molkentin,J.D., Srivastava,D.,
            Ocorr,K., Bruneau,B.G. and Bodmer,R.
  TITLE     Tinman/Nkx2-5 acts via miR-1 and upstream of Cdc42 to regulate
            heart function across species
  JOURNAL   J Cell Biol 193 (7), 1181-1196 (2011)
   PUBMED   21690310
REFERENCE   3  (bases 1 to 111)
  AUTHORS   Linsen,S.E., de Wit,E., de Bruijn,E. and Cuppen,E.
  TITLE     Small RNA expression and strain specificity in the rat
  JOURNAL   BMC Genomics 11, 249 (2010)
   PUBMED   20403161
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 111)
  AUTHORS   Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and
            Enright,A.J.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from JAXUCZ010000018.1.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
            
            ##Evidence-Data-START##
            Transcript is intronless :: SRR22582419.2510969.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-111               JAXUCZ010000018.1  2160316-2160426
FEATURES             Location/Qualifiers
     source          1..111
                     /organism="Rattus norvegicus"
                     /mol_type="transcribed RNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="18"
                     /map="18p13"
     gene            1..111
                     /gene="Mir1b"
                     /gene_synonym="Mir3571; rno-mir-3571"
                     /note="microRNA 1b"
                     /db_xref="GeneID:100526624"
                     /db_xref="miRBase:MI0015440"
                     /db_xref="RGD:4888552"
     precursor_RNA   1..111
                     /gene="Mir1b"
                     /gene_synonym="Mir3571; rno-mir-3571"
                     /product="microRNA 1b"
                     /db_xref="GeneID:100526624"
                     /db_xref="miRBase:MI0015440"
                     /db_xref="RGD:4888552"
     exon            1..111
                     /gene="Mir1b"
                     /gene_synonym="Mir3571; rno-mir-3571"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           25..47
                     /ncRNA_class="miRNA"
                     /gene="Mir1b"
                     /gene_synonym="Mir3571; rno-mir-3571"
                     /product="rno-miR-3571"
                     /db_xref="miRBase:MIMAT0017851"
                     /db_xref="GeneID:100526624"
                     /db_xref="miRBase:MI0015440"
                     /db_xref="RGD:4888552"
ORIGIN      

ttggcggacattacctacccaaaatacacacttctttacattccatagcattctatgttcatatgggtacataaagaagtatgtgctctgagtaggcactattgtgccgat

//