LOCUS       NR_031807                 83 bp    RNA     linear   ROD 02-APR-2024
DEFINITION  Rattus norvegicus microRNA let-7f-2 (Mirlet7f2), microRNA.
ACCESSION   NR_031807
VERSION     NR_031807.1
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 83)
  AUTHORS   Gu,Q.H., Yu,D., Hu,Z., Liu,X., Yang,Y., Luo,Y., Zhu,J. and Li,Z.
  TITLE     miR-26a and miR-384-5p are required for LTP maintenance and spine
            enlargement
  JOURNAL   Nat Commun 6, 6789 (2015)
   PUBMED   25858512
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 83)
  AUTHORS   Li,C.J., Cheng,P., Liang,M.K., Chen,Y.S., Lu,Q., Wang,J.Y.,
            Xia,Z.Y., Zhou,H.D., Cao,X., Xie,H., Liao,E.Y. and Luo,X.H.
  TITLE     MicroRNA-188 regulates age-related switch between osteoblast and
            adipocyte differentiation
  JOURNAL   J Clin Invest 125 (4), 1509-1522 (2015)
   PUBMED   25751060
REFERENCE   3  (bases 1 to 83)
  AUTHORS   Polikepahad,S. and Corry,D.B.
  TITLE     Profiling of T helper cell-derived small RNAs reveals unique
            antisense transcripts and differential association of miRNAs with
            argonaute proteins 1 and 2
  JOURNAL   Nucleic Acids Res 41 (2), 1164-1177 (2013)
   PUBMED   23185045
REFERENCE   4  (bases 1 to 83)
  AUTHORS   Pogribny,I.P., Starlard-Davenport,A., Tryndyak,V.P., Han,T.,
            Ross,S.A., Rusyn,I. and Beland,F.A.
  TITLE     Difference in expression of hepatic microRNAs miR-29c, miR-34a,
            miR-155, and miR-200b is associated with strain-specific
            susceptibility to dietary nonalcoholic steatohepatitis in mice
  JOURNAL   Lab Invest 90 (10), 1437-1446 (2010)
   PUBMED   20548288
REFERENCE   5  (bases 1 to 83)
  AUTHORS   Linsen,S.E., de Wit,E., de Bruijn,E. and Cuppen,E.
  TITLE     Small RNA expression and strain specificity in the rat
  JOURNAL   BMC Genomics 11, 249 (2010)
   PUBMED   20403161
  REMARK    Publication Status: Online-Only
REFERENCE   6  (bases 1 to 83)
  AUTHORS   He,X., Zhang,Q., Liu,Y. and Pan,X.
  TITLE     Cloning and identification of novel microRNAs from rat hippocampus
  JOURNAL   Acta Biochim Biophys Sin (Shanghai) 39 (9), 708-714 (2007)
   PUBMED   17805466
REFERENCE   7  (bases 1 to 83)
  AUTHORS   Landgraf,P., Rusu,M., Sheridan,R., Sewer,A., Iovino,N., Aravin,A.,
            Pfeffer,S., Rice,A., Kamphorst,A.O., Landthaler,M., Lin,C.,
            Socci,N.D., Hermida,L., Fulci,V., Chiaretti,S., Foa,R.,
            Schliwka,J., Fuchs,U., Novosel,A., Muller,R.U., Schermer,B.,
            Bissels,U., Inman,J., Phan,Q., Chien,M., Weir,D.B., Choksi,R., De
            Vita,G., Frezzetti,D., Trompeter,H.I., Hornung,V., Teng,G.,
            Hartmann,G., Palkovits,M., Di Lauro,R., Wernet,P., Macino,G.,
            Rogler,C.E., Nagle,J.W., Ju,J., Papavasiliou,F.N., Benzing,T.,
            Lichter,P., Tam,W., Brownstein,M.J., Bosio,A., Borkhardt,A.,
            Russo,J.J., Sander,C., Zavolan,M. and Tuschl,T.
  TITLE     A mammalian microRNA expression atlas based on small RNA library
            sequencing
  JOURNAL   Cell 129 (7), 1401-1414 (2007)
   PUBMED   17604727
REFERENCE   8  (bases 1 to 83)
  AUTHORS   Watanabe,T., Takeda,A., Tsukiyama,T., Mise,K., Okuno,T., Sasaki,H.,
            Minami,N. and Imai,H.
  TITLE     Identification and characterization of two novel classes of small
            RNAs in the mouse germline: retrotransposon-derived siRNAs in
            oocytes and germline small RNAs in testes
  JOURNAL   Genes Dev 20 (13), 1732-1743 (2006)
   PUBMED   16766679
REFERENCE   9  (bases 1 to 83)
  AUTHORS   Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and
            Enright,A.J.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
REFERENCE   10 (bases 1 to 83)
  AUTHORS   Kim,J., Krichevsky,A., Grad,Y., Hayes,G.D., Kosik,K.S., Church,G.M.
            and Ruvkun,G.
  TITLE     Identification of many microRNAs that copurify with polyribosomes
            in mammalian neurons
  JOURNAL   Proc Natl Acad Sci U S A 101 (1), 360-365 (2004)
   PUBMED   14691248
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from JAXUCZ010000021.1.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript is intronless :: SRR26360186.616826.1,
                                        SRR26360194.508047.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-83                JAXUCZ010000021.1  24460045-24460127
FEATURES             Location/Qualifiers
     source          1..83
                     /organism="Rattus norvegicus"
                     /mol_type="transcribed RNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="X"
                     /map="Xq13"
     gene            1..83
                     /gene="Mirlet7f2"
                     /gene_synonym="Mirlet7f-2; rno-let-7f-2"
                     /note="microRNA let-7f-2"
                     /db_xref="GeneID:100313992"
                     /db_xref="miRBase:MI0000834"
                     /db_xref="RGD:2325605"
     precursor_RNA   1..83
                     /gene="Mirlet7f2"
                     /gene_synonym="Mirlet7f-2; rno-let-7f-2"
                     /product="microRNA let-7f-2"
                     /db_xref="GeneID:100313992"
                     /db_xref="miRBase:MI0000834"
                     /db_xref="RGD:2325605"
     exon            1..83
                     /gene="Mirlet7f2"
                     /gene_synonym="Mirlet7f-2; rno-let-7f-2"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           8..29
                     /ncRNA_class="miRNA"
                     /gene="Mirlet7f2"
                     /gene_synonym="Mirlet7f-2; rno-let-7f-2"
                     /product="rno-let-7f-5p"
                     /db_xref="miRBase:MIMAT0000778"
                     /db_xref="GeneID:100313992"
                     /db_xref="miRBase:MI0000834"
                     /db_xref="RGD:2325605"
     ncRNA           58..78
                     /ncRNA_class="miRNA"
                     /gene="Mirlet7f2"
                     /gene_synonym="Mirlet7f-2; rno-let-7f-2"
                     /product="rno-let-7f-2-3p"
                     /db_xref="miRBase:MIMAT0017090"
                     /db_xref="GeneID:100313992"
                     /db_xref="miRBase:MI0000834"
                     /db_xref="RGD:2325605"
ORIGIN      

tgtgggatgaggtagtagattgtatagttttagggtcataccccatcttggagataactatacagtctactgtctttcccacg

//