GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-06 19:49:32, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NM_176857               3864 bp    mRNA    linear   ROD 20-MAR-2023
DEFINITION  Rattus norvegicus valosin containing protein interacting protein 1
            (Vcpip1), mRNA.
ACCESSION   NM_176857
VERSION     NM_176857.3
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 3864)
  AUTHORS   Mevissen TE, Hospenthal MK, Geurink PP, Elliott PR, Akutsu M,
            Arnaudo N, Ekkebus R, Kulathu Y, Wauer T, El Oualid F, Freund SM,
            Ovaa H and Komander D.
  TITLE     OTU deubiquitinases reveal mechanisms of linkage specificity and
            enable ubiquitin chain restriction analysis
  JOURNAL   Cell 154 (1), 169-184 (2013)
   PUBMED   23827681
REFERENCE   2  (bases 1 to 3864)
  AUTHORS   Totsukawa G, Kaneko Y, Uchiyama K, Toh H, Tamura K and Kondo H.
  TITLE     VCIP135 deubiquitinase and its binding protein, WAC, in
            p97ATPase-mediated membrane fusion
  JOURNAL   EMBO J 30 (17), 3581-3593 (2011)
   PUBMED   21811234
  REMARK    GeneRIF: WAC is hence thought to function in p97/p47-mediated Golgi
            membrane fusion by activating the deubiquitinating function of
            VCIP135.
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 3864)
  AUTHORS   Arakawa T, Katada A, Shigyo H, Kishibe K, Adachi M, Nonaka S and
            Harabuchi Y.
  TITLE     Electrical stimulation prevents apoptosis in denervated skeletal
            muscle
  JOURNAL   NeuroRehabilitation 27 (2), 147-154 (2010)
   PUBMED   20871144
  REMARK    GeneRIF: Electrical stimulation increased valosin-containing
            protein (VCP) expression and decreased cleaved caspase-12
            expression in denervated muscles.
REFERENCE   4  (bases 1 to 3864)
  AUTHORS   Faouzi S, Medzihradszky KF, Hefner C, Maher JJ and Correia MA.
  TITLE     Characterization of the physiological turnover of native and
            inactivated cytochromes P450 3A in cultured rat hepatocytes: a role
            for the cytosolic AAA ATPase p97?
  JOURNAL   Biochemistry 46 (26), 7793-7803 (2007)
   PUBMED   17550236
  REMARK    GeneRIF: findings clearly reveal that native CYPs 3A undergo UPD
            and implicate a role for p97 in this process.
REFERENCE   5  (bases 1 to 3864)
  AUTHORS   Trinidad JC, Specht CG, Thalhammer A, Schoepfer R and Burlingame
            AL.
  TITLE     Comprehensive identification of phosphorylation sites in
            postsynaptic density preparations
  JOURNAL   Mol Cell Proteomics 5 (5), 914-922 (2006)
   PUBMED   16452087
REFERENCE   6  (bases 1 to 3864)
  AUTHORS   Yamamoto S, Tomita Y, Hoshida Y, Iizuka N, Kidogami S, Miyata H,
            Takiguchi S, Fujiwara Y, Yasuda T, Yano M, Nakamori S, Sakon M,
            Monden M and Aozasa K.
  TITLE     Expression level of valosin-containing protein (p97) is associated
            with prognosis of esophageal carcinoma
  JOURNAL   Clin Cancer Res 10 (16), 5558-5565 (2004)
   PUBMED   15328197
  REMARK    GeneRIF: Expression is ignificant in the prognosis of esophageal
            squamous cell carcinoma
REFERENCE   7  (bases 1 to 3864)
  AUTHORS   Wang Y, Satoh A, Warren G and Meyer HH.
  TITLE     VCIP135 acts as a deubiquitinating enzyme during p97-p47-mediated
            reassembly of mitotic Golgi fragments
  JOURNAL   J Cell Biol 164 (7), 973-978 (2004)
   PUBMED   15037600
  REMARK    GeneRIF: p97-p47-mediated reassembly of Golgi cisternae requires
            ubiquitin, but is not dependent on proteasome-mediated proteolysis.
            Erratum:[J Cell Biol. 2004 Aug 2;166(3):433. Wang, Yangzhuang
            [corrected to Wang, Yanzhuang]]
REFERENCE   8  (bases 1 to 3864)
  AUTHORS   Uchiyama K, Jokitalo E, Lindman M, Jackman M, Kano F, Murata M,
            Zhang X and Kondo H.
  TITLE     The localization and phosphorylation of p47 are important for Golgi
            disassembly-assembly during the cell cycle
  JOURNAL   J Cell Biol 161 (6), 1067-1079 (2003)
   PUBMED   12810701
  REMARK    GeneRIF: P47 localizes to the nucleus during interphase and is
            phosphorylated on Serine-140 by Cdc2 at mitosis. Phosphorylated p47
            does not bind to Golgi membranes.
REFERENCE   9  (bases 1 to 3864)
  AUTHORS   Uchiyama K, Jokitalo E, Kano F, Murata M, Zhang X, Canas B, Newman
            R, Rabouille C, Pappin D, Freemont P and Kondo H.
  TITLE     VCIP135, a novel essential factor for p97/p47-mediated membrane
            fusion, is required for Golgi and ER assembly in vivo
  JOURNAL   J Cell Biol 159 (5), 855-866 (2002)
   PUBMED   12473691
  REMARK    GeneRIF: VCIP135 is required for golgi and endoplasmic reticulum
            assembly.
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AB045378.2.
            
            On Jun 10, 2007 this sequence version replaced NM_176857.2.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AB045378.2, AF289091.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMD00132261, SAMD00132263
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..3864
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /db_xref="taxon:10116"
                     /chromosome="5"
                     /map="5q11"
     gene            1..3864
                     /gene="Vcpip1"
                     /gene_synonym="Vcip135"
                     /note="valosin containing protein interacting protein 1"
                     /db_xref="GeneID:286761"
                     /db_xref="RGD:708520"
     exon            1..2824
                     /gene="Vcpip1"
                     /gene_synonym="Vcip135"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    40..42
                     /gene="Vcpip1"
                     /gene_synonym="Vcip135"
                     /note="upstream in-frame stop codon"
     CDS             118..3783
                     /gene="Vcpip1"
                     /gene_synonym="Vcip135"
                     /EC_number="3.4.19.12"
                     /note="deubiquitinating protein VCIP135;
                     valosin-containing protein p97/p47 complex-interacting
                     protein 1; valosin-containing protein p97/p47
                     complex-interacting protein p135; VCP(p97)/p47-interacting
                     protein; valosin-containing protein (p97)/p47
                     complex-interacting protein 135; VCP/p47
                     complex-interacting 135-kDa protein"
                     /codon_start=1
                     /product="deubiquitinating protein VCPIP1"
                     /protein_id="NP_789827.3"
                     /db_xref="GeneID:286761"
                     /db_xref="RGD:708520"
                     /translation="
MSQPPPPPPLPPPPPPPEAPQTSSSLAAAATPGGLSKRRDRRILSGSCPDPKCQARLFFPASGSVSIECTECGQRHEQQQLLGVEEVTDPDVVLHNLLRNALLGVTGAPKKNTELVKVMGLSNYHCKLLSPILARYGMDKQTGRAKLLRDMNQGELFDCALLGDRAFLIEPEHVNTVGYGKDRSGSLLYLHDTLEDIKRANKSQECLIPVHVDGDGHCLVHAVSRALVGRELFWHALRENLKQHFQQHLARYQALFHDFIDAAEWEDIINECDPLFVPPEGVPLGLRNIHIFGLANVLHRPIILLDSLSGMRSSGDYSATFLPGLIPAEKCTGRDGHLNKPICIAWSSSGRNHYIPLVGIKGAALPKLPMNLLPKAWGVPQDLIKKYIKLEEDGGCVIGGDRSLQDKYLLRLVAAMEEVFMDKHGIHPSLVADVHQYFYRRTGVIGVQPEEVTAAAKKAVMDNRLHKCLLCGALSELHVPPEWLAPGGKLYNLAKSTHGQLRPDKNYSFPLNNLVCSYDPVKDVLLPDYGLSNLTACNWCHGTSVRRVRGDGSIVYLDGDRTNSRSTGGKCGCGFKHFWEGKEYDNLPEAFPITLEWGGRVVRETVYWFQYESDPSLNSNVYDVAMKLVTKHFPGEFGSEILVQKVVHTILHQTAKKNPDDYTPVNIDGAHAQRIGDVQGQELESQLPTKIILTGQKTKTLHKEELNMSKTERTIQQNITEQASVMQKRKTEKLKQEQKGQPRTVSPSTIRDGPSSAPATPTKAPYSPTTSKEKKIRITTNDGRQSMVTLKSSTTFFELQESIAREFNIPPYLQCIRYGFPPKELMPPQAGMEKEPVPLQHGDRITIEILKGKAEGGPSTAAHSAHTVRQEEIAVTGKLSSKELQEQADKEMYSLCLLATLMGEDVWSYAKGLPHMFQQGGVFYNIMKKTMGMADGKHCTFPHLPGKTFVYNASEDRLELCVDAAGHFPIGPDVEDLVKEAVSQVRAEATTRSRESSPSHGLLKLGSGGVVKKKSEQLHNVTAFQGKGHSLGTASSNPHMDPRARETLAVRKHNTGTDFSNSSIKTEPPVFTAASSNSELIRIAPGVVTMRDGRQIDPDVVEAQRKKLQEMVSSIQASMDKHLRDQSTEQTPSDLSQRKVEAVSSSVRPGNLQTGLPESFSLTGGTENLNTETTDSRVADVLGAAFATRSKAQKENSMEEPEEMDSQDAETTNTTEPMDHS"
     misc_feature    118..237
                     /gene="Vcpip1"
                     /gene_synonym="Vcip135"
                     /note="propagated from UniProtKB/Swiss-Prot (Q8CF97.2);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    223..720
                     /gene="Vcpip1"
                     /gene_synonym="Vcip135"
                     /note="VCIP135 N-terminal; Region: VCIP135_N; pfam19437"
                     /db_xref="CDD:437269"
     misc_feature    604..1194
                     /gene="Vcpip1"
                     /gene_synonym="Vcip135"
                     /note="OTU (ovarian tumor) domain of deubiquitinating
                     protein VCIP135; Region: OTU_VCIP135; cd22769"
                     /db_xref="CDD:438606"
     misc_feature    order(730..735,907..909,928..930,970..978,1042..1044,
                     1171..1173,1177..1179)
                     /gene="Vcpip1"
                     /gene_synonym="Vcip135"
                     /note="putative polypeptide substrate binding site
                     [polypeptide binding]; other site"
                     /db_xref="CDD:438606"
     misc_feature    order(760..762,769..771,1174..1176)
                     /gene="Vcpip1"
                     /gene_synonym="Vcip135"
                     /note="active site"
                     /db_xref="CDD:438606"
     misc_feature    1336..1338
                     /gene="Vcpip1"
                     /gene_synonym="Vcip135"
                     /note="N6-acetyllysine.
                     /evidence=ECO:0000250|UniProtKB:Q96JH7; propagated from
                     UniProtKB/Swiss-Prot (Q8CF97.2); acetylation site"
     misc_feature    2287..2451
                     /gene="Vcpip1"
                     /gene_synonym="Vcip135"
                     /note="propagated from UniProtKB/Swiss-Prot (Q8CF97.2);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    2353..2355
                     /gene="Vcpip1"
                     /gene_synonym="Vcip135"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:22673903; propagated from
                     UniProtKB/Swiss-Prot (Q8CF97.2); phosphorylation site"
     misc_feature    2383..2385
                     /gene="Vcpip1"
                     /gene_synonym="Vcip135"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:Q96JH7; propagated from
                     UniProtKB/Swiss-Prot (Q8CF97.2); phosphorylation site"
     misc_feature    2401..2403
                     /gene="Vcpip1"
                     /gene_synonym="Vcip135"
                     /note="Phosphothreonine.
                     /evidence=ECO:0000250|UniProtKB:Q96JH7; propagated from
                     UniProtKB/Swiss-Prot (Q8CF97.2); phosphorylation site"
     misc_feature    2416..2418
                     /gene="Vcpip1"
                     /gene_synonym="Vcip135"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:Q96JH7; propagated from
                     UniProtKB/Swiss-Prot (Q8CF97.2); phosphorylation site"
     misc_feature    2437..2661
                     /gene="Vcpip1"
                     /gene_synonym="Vcip135"
                     /note="ubiquitin-like (Ubl) domain found in ubiquitin
                     thioesterase OTU1 and similar proteins; Region: Ubl_OTU1;
                     cd17059"
                     /db_xref="CDD:340579"
     misc_feature    order(2446..2448,2473..2475,2566..2568,2575..2577,
                     2581..2583,2587..2589,2635..2649,2659..2661)
                     /gene="Vcpip1"
                     /gene_synonym="Vcip135"
                     /note="VCP interaction site [polypeptide binding]; other
                     site"
                     /db_xref="CDD:340579"
     misc_feature    3079..3144
                     /gene="Vcpip1"
                     /gene_synonym="Vcip135"
                     /note="propagated from UniProtKB/Swiss-Prot (Q8CF97.2);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    3094..3096
                     /gene="Vcpip1"
                     /gene_synonym="Vcip135"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:Q96JH7; propagated from
                     UniProtKB/Swiss-Prot (Q8CF97.2); phosphorylation site"
     misc_feature    3106..3108
                     /gene="Vcpip1"
                     /gene_synonym="Vcip135"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:Q96JH7; propagated from
                     UniProtKB/Swiss-Prot (Q8CF97.2); phosphorylation site"
     misc_feature    3343..3345
                     /gene="Vcpip1"
                     /gene_synonym="Vcip135"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:Q96JH7; propagated from
                     UniProtKB/Swiss-Prot (Q8CF97.2); phosphorylation site"
     misc_feature    3466..3648
                     /gene="Vcpip1"
                     /gene_synonym="Vcip135"
                     /note="propagated from UniProtKB/Swiss-Prot (Q8CF97.2);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    3682..3780
                     /gene="Vcpip1"
                     /gene_synonym="Vcip135"
                     /note="propagated from UniProtKB/Swiss-Prot (Q8CF97.2);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    3706..3708
                     /gene="Vcpip1"
                     /gene_synonym="Vcip135"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:22673903; propagated from
                     UniProtKB/Swiss-Prot (Q8CF97.2); phosphorylation site"
     misc_feature    3733..3735
                     /gene="Vcpip1"
                     /gene_synonym="Vcip135"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:Q96JH7; propagated from
                     UniProtKB/Swiss-Prot (Q8CF97.2); phosphorylation site"
     exon            2825..2911
                     /gene="Vcpip1"
                     /gene_synonym="Vcip135"
                     /inference="alignment:Splign:2.1.0"
     exon            2912..3864
                     /gene="Vcpip1"
                     /gene_synonym="Vcip135"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
ctggtagggaaaggaaagccattcgctctgggcctggactagacctcgtcgggccggcggaggtctggctatgtgcctttgagggtcgcttgggacgcagagcgagagccgagagcgatgtctcagccgccgccgcctcctccgctgccgccgccgccgcctccccccgaggctccgcagacttcgtcgtccctggcggcggcggctactccggggggcctttcgaaacgaagggaccggagaatcctttccgggagctgcccggatcccaagtgccaggcgcggctcttcttcccggcctcaggttctgtcagcatcgagtgtaccgagtgcggacagcggcacgagcagcaacagctgctgggagtggaggaggtgaccgacccggacgtagtgctgcacaatctgctgcggaacgcgctactcggggtgacgggggctcccaagaagaacacggaactggtaaaggtgatgggcctctccaactaccactgcaaattattgtcgcccatattggcacgctatggaatggacaaacaaacgggccgcgccaagcttctccgggacatgaaccaaggcgaactgttcgattgcgcgttactcggtgaccgggccttcctcatcgaaccagagcacgtcaacacagtgggctatggcaaggaccgatctggaagcctcctatatttgcatgacactctcgaggatatcaaacgggccaataaaagtcaagaatgccttattccagtgcatgtggatggggatggacactgcctagtgcatgctgtgtctagggctctagtaggccgagagctcttctggcatgccctgagggagaatctgaagcagcactttcagcagcacctagcccgatatcaagccctgtttcatgactttattgatgctgcagagtgggaggacattatcaatgaatgtgaccctctgtttgtgccacctgaaggtgtccccttaggcctgaggaatatccacatatttggccttgccaatgtgttacatcgtcccataattctcttagattccctcagtggcatgagaagctctggtgattattcagccacctttctacctgggctcatacctgcagagaagtgcactgggagagatggtcatttgaacaagccaatctgtattgcgtggagtagctctggtagaaaccattatattcccttggtaggcataaagggggctgccttgcccaaactacccatgaatttgctacctaaagcatggggtgtgcctcaggaccttattaaaaagtacatcaagcttgaggaggatggtggttgtgttattggaggagacagaagtttgcaggataagtacttacttaggttggttgctgctatggaggaagtctttatggacaaacatggtatccatcctagtttggttgctgatgtacatcagtatttctacagaaggactggggtgataggagttcagcctgaggaagttacagcagctgctaaaaaagcagtaatggataatcgccttcacaagtgtttgctttgtggtgccctttctgaacttcatgtccctcctgagtggttggctccaggaggaaaactgtataacctggcaaaaagtactcatggacagctgaggcctgacaaaaattacagctttcctttaaacaatttggtttgttcatatgatccagtgaaagatgttctgttaccagactatggattgagtaatctaacagcttgtaattggtgccatggcacatctgtgcgaagagtcagaggcgatggctctattgtatatttggatggagacagaactaattctaggtctactggtggcaaatgtggttgtggattcaaacacttttgggaaggtaaagaatatgacaaccttccagaagcttttcctatcactttggagtggggaggaagagtagtcagagaaacagtatattggttccagtatgaaagtgatccatctttgaatagtaatgtttatgatgttgcaatgaaacttgttaccaagcactttccaggtgaatttgggagtgagatcctagttcagaaagttgtccacactatattgcatcagactgcaaaaaaaaatcctgacgattacactcctgtaaatatagatggtgctcatgctcagagaattggagatgtgcaaggacaagaattggagtctcagctaccaactaaaattattcttactggacagaaaacaaaaactttgcacaaggaagaattaaacatgagtaaaactgaaagaactattcaacagaacatcacagaacaagcttctgtgatgcagaaacggaaaacagagaaattaaaacaagagcaaaaggggcaacccagaactgtttctccaagtactattcgtgatgggccttcatctgcacctgccacccccacgaaggctccctactcacctaccacttctaaggagaagaagattcgcataacaactaatgatggacggcagtccatggttacccttaagtcttcaacaaccttttttgaacttcaggaaagtatagccagagagttcaacattcctccatatttacagtgtattcgatatggttttcctcctaaagagttaatgccaccccaagcaggaatggaaaaggagccagttcctttgcagcatggtgacagaattaccatagagatcttaaaaggcaaagcagaaggtggtccatccactgctgcacactcagcccacactgtgagacaagaagagattgctgttactggcaagctgtcctccaaggaacttcaggagcaagctgacaaagaaatgtattccttgtgtcttttagcaacattaatgggagaagacgtgtggtcttatgcaaagggacttcctcacatgttccagcagggtggtgtattctacaatattatgaagaaaactatgggcatggctgatggcaaacattgtacttttccacatctacctggcaaaacctttgtttataatgcttctgaagacagactggagttgtgtgtcgatgccgcaggacatttccccattggtcctgatgttgaagatttagttaaagaggctgtaagtcaggttcgagcagaggctactacaagaagtagggaatcaagcccttcacatgggttattaaaactaggtagtggtggagtagtgaaaaagaagtctgagcaacttcacaatgtaactgcctttcaggggaagggccattctctaggaactgcatccagtaacccgcacatggatcccagagctagggaaactctggctgtaagaaagcataatacagggacagattttagtaatagttccattaaaacagagcctcctgtgttcacagctgcttctagtaatagtgagcttattcgaatagctcctggagtggtaacaatgagagatggtaggcagattgatcccgatgtggttgaggcccagcgaaaaaaattgcaggaaatggtttcttctattcaggcatcaatggacaagcacttgcgggatcaaagtacagagcaaacaccatctgatctttctcaaagaaaagtagaagctgtgagttcttctgtgaggcctgggaatcttcagactggcttgcctgaatctttttctttaactggtggcactgagaatttgaatactgaaacaactgatagtcgtgtagcagatgtactgggagcagcatttgccacaaggtcaaaagcacaaaaagaaaattccatggaggaacctgaagagatggatagtcaagatgctgagacaactaacacaactgagccgatggatcactcttgatttaatttagaggctaataaaggcagatgtttattgtgaatatgtaatatttgttggctgggccacataacttgagtagtc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]