LOCUS       NM_001426997            2165 bp    mRNA    linear   ROD 24-JUN-2024
DEFINITION  Rattus norvegicus LIM homeobox 3 (Lhx3), mRNA.
ACCESSION   NM_001426997 XM_002729144
VERSION     NM_001426997.1
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 2165)
  AUTHORS   Sobrier,M.L., Tsai,Y.C., Perez,C., Leheup,B., Bouceba,T.,
            Duquesnoy,P., Copin,B., Sizova,D., Penzo,A., Stanger,B.Z.,
            Cooke,N.E., Liebhaber,S.A. and Amselem,S.
  TITLE     Functional characterization of a human POU1F1 mutation associated
            with isolated growth hormone deficiency: a novel etiology for IGHD
  JOURNAL   Hum Mol Genet 25 (3), 472-483 (2016)
   PUBMED   26612202
REFERENCE   2  (bases 1 to 2165)
  AUTHORS   Song,M.R., Sun,Y., Bryson,A., Gill,G.N., Evans,S.M. and Pfaff,S.L.
  TITLE     Islet-to-LMO stoichiometries control the function of transcription
            complexes that specify motor neuron and V2a interneuron identity
  JOURNAL   Development 136 (17), 2923-2932 (2009)
   PUBMED   19666821
REFERENCE   3  (bases 1 to 2165)
  AUTHORS   Joshi,K., Lee,S., Lee,B., Lee,J.W. and Lee,S.K.
  TITLE     LMO4 controls the balance between excitatory and inhibitory spinal
            V2 interneurons
  JOURNAL   Neuron 61 (6), 839-851 (2009)
   PUBMED   19323994
REFERENCE   4  (bases 1 to 2165)
  AUTHORS   Rajab,A., Kelberman,D., de Castro,S.C., Biebermann,H., Shaikh,H.,
            Pearce,K., Hall,C.M., Shaikh,G., Gerrelli,D., Grueters,A., Krude,H.
            and Dattani,M.T.
  TITLE     Novel mutations in LHX3 are associated with hypopituitarism and
            sensorineural hearing loss
  JOURNAL   Hum Mol Genet 17 (14), 2150-2159 (2008)
   PUBMED   18407919
REFERENCE   5  (bases 1 to 2165)
  AUTHORS   Tian,G., Singh,U., Yu,Y., Ellsworth,B.S., Hemberger,M., Geyer,R.,
            Stewart,M.D., Behringer,R.R. and Fundele,R.
  TITLE     Expression and function of the LIM homeobox containing genes Lhx3
            and Lhx4 in the mouse placenta
  JOURNAL   Dev Dyn 237 (5), 1517-1525 (2008)
   PUBMED   18425848
REFERENCE   6  (bases 1 to 2165)
  AUTHORS   Meier,B.C., Price,J.R., Parker,G.E., Bridwell,J.L. and Rhodes,S.J.
  TITLE     Characterization of the porcine Lhx3/LIM-3/P-Lim LIM homeodomain
            transcription factor
  JOURNAL   Mol Cell Endocrinol 147 (1-2), 65-74 (1999)
   PUBMED   10195693
REFERENCE   7  (bases 1 to 2165)
  AUTHORS   Sharma,K., Sheng,H.Z., Lettieri,K., Li,H., Karavanov,A., Potter,S.,
            Westphal,H. and Pfaff,S.L.
  TITLE     LIM homeodomain factors Lhx3 and Lhx4 assign subtype identities for
            motor neurons
  JOURNAL   Cell 95 (6), 817-828 (1998)
   PUBMED   9865699
REFERENCE   8  (bases 1 to 2165)
  AUTHORS   Potter,M., Wax,J. and Jones,G.M.
  TITLE     Indomethacin is a potent inhibitor of pristane and plastic disc
            induced plasmacytomagenesis in a hypersusceptible BALB/c congenic
            strain
  JOURNAL   Blood 90 (1), 260-269 (1997)
   PUBMED   9207461
REFERENCE   9  (bases 1 to 2165)
  AUTHORS   Bach,I., Carriere,C., Ostendorff,H.P., Andersen,B. and
            Rosenfeld,M.G.
  TITLE     A family of LIM domain-associated cofactors confer transcriptional
            synergism between LIM and Otx homeodomain proteins
  JOURNAL   Genes Dev 11 (11), 1370-1380 (1997)
   PUBMED   9192866
REFERENCE   10 (bases 1 to 2165)
  AUTHORS   Sheng,H.Z., Zhadanov,A.B., Mosinger,B. Jr., Fujii,T., Bertuzzi,S.,
            Grinberg,A., Lee,E.J., Huang,S.P., Mahon,K.A. and Westphal,H.
  TITLE     Specification of pituitary cell lineages by the LIM homeobox gene
            Lhx3
  JOURNAL   Science 272 (5264), 1004-1007 (1996)
   PUBMED   8638120
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JAXUCZ010000003.1.
            
            On Jan 9, 2024 this sequence version replaced XM_002729144.6.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR26360190.337365.1,
                                           SRR26360172.315345.1 [ECO:0000332]
            RNAseq introns              :: mixed sample support SAMEA5760383,
                                           SAMEA5760389 [ECO:0006172]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on expression
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-148               JAXUCZ010000003.1  29432490-29432637   c
            149-320             JAXUCZ010000003.1  29428308-29428479   c
            321-523             JAXUCZ010000003.1  29427419-29427621   c
            524-675             JAXUCZ010000003.1  29426789-29426940   c
            676-844             JAXUCZ010000003.1  29426533-29426701   c
            845-2165            JAXUCZ010000003.1  29424620-29425940   c
FEATURES             Location/Qualifiers
     source          1..2165
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="3"
                     /map="3p13"
     gene            1..2165
                     /gene="Lhx3"
                     /note="LIM homeobox 3"
                     /db_xref="GeneID:170671"
                     /db_xref="RGD:71078"
     exon            1..148
                     /gene="Lhx3"
                     /inference="alignment:Splign:2.1.0"
     CDS             61..1263
                     /gene="Lhx3"
                     /note="LIM homeobox protein 3; LIM homeodomain protein 3a"
                     /codon_start=1
                     /product="LIM/homeobox protein Lhx3"
                     /protein_id="NP_001413926.1"
                     /db_xref="GeneID:170671"
                     /db_xref="RGD:71078"
                     /translation="

MLLEAELDCHREQPGAPGAAALCTFSRTPEIPMCAGCDQHILDRFILKALDRHWHSKCLKCSDCHVPLAERCFSRGESVYCKDDFFKRFGTKCAACQLGIPPTQVVRRAQDFVYHLHCFACVVCKRQLATGDEFYLMEDSRLVCKADYETAKQREAEATAKRPRTTITAKQLETLKSAYNTSPKPARHVREQLSSETGLDMRVVQVWFQNRRAKEKRLKKDAGRQRWGQYFRNMKRSRGSSKSDKDSIQEGQDSDAEVSFTDEPSMADMGTANGLYSSLGEPAPALGRPVGGLGSFTLEHGGLAGPEQFRELRPGSPYGIPPSPAAPQSLPGPQPLLSSLVYPDTNLGLVPSGPPGGPPPMRVLAGNGPSSDLSTESSGGYPDFPASPASWLDEVDHAQF"

     exon            149..320
                     /gene="Lhx3"
                     /inference="alignment:Splign:2.1.0"
     exon            321..523
                     /gene="Lhx3"
                     /inference="alignment:Splign:2.1.0"
     exon            524..675
                     /gene="Lhx3"
                     /inference="alignment:Splign:2.1.0"
     exon            676..844
                     /gene="Lhx3"
                     /inference="alignment:Splign:2.1.0"
     exon            845..2165
                     /gene="Lhx3"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

ctgaaacaggtccagcactccagggaacacccagcaggaaccactggattagtgactaccatgctgttagaagcggaactcgattgccaccgagagcagcccggtgcccctggagctgctgccctctgtaccttcagcaggactccagagatccccatgtgcgcgggatgtgaccagcacatcttggaccgtttcatcctaaaggctctggaccgacattggcacagcaagtgtctcaagtgcagtgactgccacgtgcctctggctgagcgctgcttcagccgcggggagagcgtctactgcaaagacgacttctttaagcgcttcgggaccaagtgcgccgcatgccagctgggcatcccgcccacgcaggtggtgcggcgcgcccaggacttcgtgtaccacctgcattgcttcgcctgcgtggtttgcaagcggcagctggccacgggggacgagttctacctcatggaagacagccggctggtgtgcaaggcggactacgaaacagccaagcagcgagaagccgaggccacagccaagcggccgcgcaccaccatcaccgccaagcagctggagacgctgaagagcgcctacaacacctcgcccaagccggcgcgccacgtgcgcgagcagctctcctccgagaccggcctggacatgcgcgtggtgcaggtgtggttccagaaccgccgggccaaggaaaagagactgaagaaagacgcaggccggcagcgctggggacagtatttccgcaatatgaagcgctcccgcggcagctccaagtccgacaaggacagcatccaggagggacaggacagcgacgcggaagtctccttcactgatgagccgtccatggctgacatggggactgctaatggcctgtacagcagcctgggagagcctgcccctgcgttgggccggcctgtaggaggcctgggcagctttacattggagcacggaggtttggcaggtccagagcagtttcgagagctgcgtccaggcagcccctatggcatcccaccatctcctgcggccccacagagccttcccggcccccagcctctcctctccagcctggtatacccagacaccaacttgggccttgtcccttcggggcctccaggtgggcccccacccatgagggtgctggctggaaatggacccagctctgacctctccacagagagcagtggtggctacccagactttcctgctagccctgcctcctggctggatgaagtagaccatgctcagttctgaccgagggccccccagttcccttggctctaactcaggggtcttggtgctgcctctgggtgggcagctagccccaccccatgatgtccatttcaaggacctctgagggaaggacagggttcccacgtgagagaatagagactgtcccacttccagcttctctggctgctccctggggctgagggactccatagcccttccttggacacaagcgtagcctgcctcgtgggcggctacaagccagtgattcttgaccgttctggtaagcattgttctccctttatcagccagtgaactcttgctgctattttccacagggcaggaggccaggccctacctagtgtcctggcataaaacaatagtaacaacttgcgtcatcacttctgatgggcttggtaggagactgtgctcggccagccgtgcctggtcactgacctctcctcccagctgccagctctcctgacctggagtctccaggtctttctgttctggaatgcaatgcgttggggagtggagctttctggaaccccttctccaaggtgtagtctttaaacgtgaagacaattccctttctcctgaggcacagcctccctcaggtgcagagcagaaatgtgcagcaaggacagacaccgttgccaaacagactgtggtcctgtgcagggggtggggtgttctgtcagcccagaccaggagacctcccccactggaggaggttgggctgggggggtcctcccaatccagtctgtctcagacacaaagcttggccatgtgtcagttaaagtcactcctgaaaaccaggatcttggctacctgttggttctgtaaacatcctgtgacttttatttattccccggtgatccgctctttccaagacttcaataaatttgtcagtttccatgctagaa

//