LOCUS       NM_001401062            2498 bp    mRNA    linear   ROD 31-DEC-2022
DEFINITION  Rattus norvegicus janus kinase and microtubule interacting protein
            1 (Jakmip1), transcript variant 5, mRNA.
ACCESSION   NM_001401062
VERSION     NM_001401062.1
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 2498)
  AUTHORS   Berg JM, Lee C, Chen L, Galvan L, Cepeda C, Chen JY, Penagarikano
            O, Stein JL, Li A, Oguro-Ando A, Miller JA, Vashisht AA, Starks ME,
            Kite EP, Tam E, Gdalyahu A, Al-Sharif NB, Burkett ZD, White SA,
            Fears SC, Levine MS, Wohlschlegel JA and Geschwind DH.
  TITLE     JAKMIP1, a Novel Regulator of Neuronal Translation, Modulates
            Synaptic Function and Autistic-like Behaviors in Mouse
  JOURNAL   Neuron 88 (6), 1173-1191 (2015)
   PUBMED   26627310
REFERENCE   2  (bases 1 to 2498)
  AUTHORS   Vidal RL, Fuentes P, Valenzuela JI, Alvarado-Diaz CP, Ramirez OA,
            Kukuljan M and Couve A.
  TITLE     RNA interference of Marlin-1/Jakmip1 results in abnormal
            morphogenesis and migration of cortical pyramidal neurons
  JOURNAL   Mol Cell Neurosci 51 (1-2), 1-11 (2012)
   PUBMED   22828129
  REMARK    GeneRIF: RNA interference of Marlin-1 in vivo results in abnormal
            migration and abnormal morphology of newborn pyramidal neurons
            during the formation of the cortex.
REFERENCE   3  (bases 1 to 2498)
  AUTHORS   Vidal RL, Valenzuela JI, Lujan R and Couve A.
  TITLE     Cellular and subcellular localization of Marlin-1 in the brain
  JOURNAL   BMC Neurosci 10, 37 (2009)
   PUBMED   19386132
  REMARK    GeneRIF: Marlin-1 is enriched in restricted areas of the brain
            including olfactory bulb, cerebral cortex, hippocampus and
            cerebellum; it is abundant in dendrites and axons of hippocampal
            neurons, associated with microtubules at the ultrastructural level.
            Publication Status: Online-Only
REFERENCE   4  (bases 1 to 2498)
  AUTHORS   Vidal RL, Ramirez A, Castro M, Concha II and Couve A.
  TITLE     Marlin-1 is expressed in testis and associates to the cytoskeleton
            and GABAB receptors
  JOURNAL   J Cell Biochem 103 (3), 886-895 (2008)
   PUBMED   17668444
  REMARK    GeneRIF: Our findings demonstrate that Marlin-1 associates with a
            microtubule fraction and with GABA(B) receptors in testis
            suggesting that the set of protein interactions of Marlin-1 are
            conserved in different tissues.
REFERENCE   5  (bases 1 to 2498)
  AUTHORS   Nishimura Y, Martin CL, Vazquez-Lopez A, Spence SJ,
            Alvarez-Retuerto AI, Sigman M, Steindler C, Pellegrini S, Schanen
            NC, Warren ST and Geschwind DH.
  TITLE     Genome-wide expression profiling of lymphoblastoid cell lines
            distinguishes different forms of autism and reveals shared pathways
  JOURNAL   Hum Mol Genet 16 (14), 1682-1698 (2007)
   PUBMED   17519220
REFERENCE   6  (bases 1 to 2498)
  AUTHORS   Vidal RL, Ramirez OA, Sandoval L, Koenig-Robert R, Hartel S and
            Couve A.
  TITLE     Marlin-1 and conventional kinesin link GABAB receptors to the
            cytoskeleton and regulate receptor transport
  JOURNAL   Mol Cell Neurosci 35 (3), 501-512 (2007)
   PUBMED   17532644
REFERENCE   7  (bases 1 to 2498)
  AUTHORS   Couve A, Restituito S, Brandon JM, Charles KJ, Bawagan H, Freeman
            KB, Pangalos MN, Calver AR and Moss SJ.
  TITLE     Marlin-1, a novel RNA-binding protein associates with GABA
            receptors
  JOURNAL   J Biol Chem 279 (14), 13934-13943 (2004)
   PUBMED   14718537
  REMARK    GeneRIF: Marlin-1 functions to regulate the cellular levels of
            GABA(B) R2 subunits, which may have significant effects on the
            production of functional GABA(B) receptor heterodimers.
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JACYVU010000254.1.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            ##Evidence-Data-START##
            RNAseq introns :: mixed/partial sample support SAMD00132261,
                              SAMD00132263 [ECO:0000350]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            inferred exon combination :: based on alignments, homology
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-248               JACYVU010000254.1  27467883-27468130   c
            249-511             JACYVU010000254.1  27408432-27408694   c
            512-1006            JACYVU010000254.1  27402371-27402865   c
            1007-1216           JACYVU010000254.1  27392753-27392962   c
            1217-1336           JACYVU010000254.1  27391706-27391825   c
            1337-1483           JACYVU010000254.1  27389166-27389312   c
            1484-1624           JACYVU010000254.1  27388347-27388487   c
            1625-1684           JACYVU010000254.1  27386877-27386936   c
            1685-1813           JACYVU010000254.1  27376683-27376811   c
            1814-1942           JACYVU010000254.1  27375213-27375341   c
            1943-2026           JACYVU010000254.1  27373168-27373251   c
            2027-2089           JACYVU010000254.1  27371977-27372039   c
            2090-2498           JACYVU010000254.1  27370091-27370499   c
FEATURES             Location/Qualifiers
     source          1..2498
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="14"
                     /map="14q21"
     gene            1..2498
                     /gene="Jakmip1"
                     /gene_synonym="Marlin-1; Marlin1"
                     /note="janus kinase and microtubule interacting protein 1"
                     /db_xref="GeneID:305434"
                     /db_xref="RGD:1562401"
     exon            1..248
                     /gene="Jakmip1"
                     /gene_synonym="Marlin-1; Marlin1"
                     /inference="alignment:Splign:2.1.0"
     exon            249..511
                     /gene="Jakmip1"
                     /gene_synonym="Marlin-1; Marlin1"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    344..346
                     /gene="Jakmip1"
                     /gene_synonym="Marlin-1; Marlin1"
                     /note="upstream in-frame stop codon"
     CDS             383..2263
                     /gene="Jakmip1"
                     /gene_synonym="Marlin-1; Marlin1"
                     /note="isoform 5 is encoded by transcript variant 5;
                     multiple alpha helices and RNA-linker protein 1; multiple
                     coiled-coil GABABR1-binding protein"
                     /codon_start=1
                     /product="janus kinase and microtubule-interacting protein
                     1 isoform 5"
                     /protein_id="NP_001387991.1"
                     /db_xref="GeneID:305434"
                     /db_xref="RGD:1562401"
                     /translation="

MSKKGRSKGEKPETETDSVQMANEELRAKLTNIQIEFQQEKSKVGKLRERLQEAKLEREQEQRRHTAYISELKAKLHEEKTKELQALREALIRQHEQEAARTAKIKEGELQRLQATLNVLRDGAADKVKTALLADAREEARRTFDGERQRLQQEILELKAARKQAEEALSNCMQADKAKAADLRAAYQAHQDEVHRIKRECERDIRRLMDEIKGKERVILALEKELGVQAGQTQRLLLQKEALDEQLVQVKEAERHHSSPKRELPPGIGDMAELMGGQDQHMDERDVRRFQLKIAELNSVIRKLEDRNTLLADERNELLKRSRETEVQLKPLVEKNKRMNKKNEDLLHSIQRMEEKLKSLTRENVEMKEKLSAQASLKRHTSLNDLSLTRDEQEIEFLRLQVLEQQHVIDDLSLERERLLRSKRHRGKSLKPPKKHVVETFFGFDEESVDSETLSETSYNTDRTDRTPATPEEDLDETTTREEADLRFCQLTREYQALQRAYALLQEQVGGTLDAEREARTREQLQADLLRCQAKIEDLEKLLVEKGQDAAWVEEKQVLMRTNQDLLEKIYRLEMEENQLKSEMQDAKDQNELLEFRVLELEVRDSICCKLSNGADILFEPKLKFV"

     misc_feature    383..1477
                     /gene="Jakmip1"
                     /gene_synonym="Marlin-1; Marlin1"
                     /note="propagated from UniProtKB/Swiss-Prot (Q3SWS9.1);
                     Region: Mediates association with microtubules.
                     /evidence=ECO:0000250"
     misc_feature    383..457
                     /gene="Jakmip1"
                     /gene_synonym="Marlin-1; Marlin1"
                     /note="propagated from UniProtKB/Swiss-Prot (Q3SWS9.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    <398..1471
                     /gene="Jakmip1"
                     /gene_synonym="Marlin-1; Marlin1"
                     /note="chromosome segregation protein SMC, primarily
                     archaeal type; Region: SMC_prok_A; TIGR02169"
                     /db_xref="CDD:274009"
     misc_feature    1475..2260
                     /gene="Jakmip1"
                     /gene_synonym="Marlin-1; Marlin1"
                     /note="propagated from UniProtKB/Swiss-Prot (Q3SWS9.1);
                     Region: Mediates interaction with TYK2 and GABBR1.
                     /evidence=ECO:0000250"
     misc_feature    1526..1528
                     /gene="Jakmip1"
                     /gene_synonym="Marlin-1; Marlin1"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:Q96N16; propagated from
                     UniProtKB/Swiss-Prot (Q3SWS9.1); phosphorylation site"
     misc_feature    1625..2194
                     /gene="Jakmip1"
                     /gene_synonym="Marlin-1; Marlin1"
                     /note="JAKMIP CC3 domain; Region: JAKMIP_CC3; pfam16034"
                     /db_xref="CDD:435088"
     misc_feature    1736..1825
                     /gene="Jakmip1"
                     /gene_synonym="Marlin-1; Marlin1"
                     /note="propagated from UniProtKB/Swiss-Prot (Q3SWS9.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    1790..1792
                     /gene="Jakmip1"
                     /gene_synonym="Marlin-1; Marlin1"
                     /note="Phosphothreonine.
                     /evidence=ECO:0000250|UniProtKB:Q96N16; propagated from
                     UniProtKB/Swiss-Prot (Q3SWS9.1); phosphorylation site"
     exon            512..1006
                     /gene="Jakmip1"
                     /gene_synonym="Marlin-1; Marlin1"
                     /inference="alignment:Splign:2.1.0"
     exon            1007..1216
                     /gene="Jakmip1"
                     /gene_synonym="Marlin-1; Marlin1"
                     /inference="alignment:Splign:2.1.0"
     exon            1217..1336
                     /gene="Jakmip1"
                     /gene_synonym="Marlin-1; Marlin1"
                     /inference="alignment:Splign:2.1.0"
     exon            1337..1483
                     /gene="Jakmip1"
                     /gene_synonym="Marlin-1; Marlin1"
                     /inference="alignment:Splign:2.1.0"
     exon            1484..1624
                     /gene="Jakmip1"
                     /gene_synonym="Marlin-1; Marlin1"
                     /inference="alignment:Splign:2.1.0"
     exon            1625..1684
                     /gene="Jakmip1"
                     /gene_synonym="Marlin-1; Marlin1"
                     /inference="alignment:Splign:2.1.0"
     exon            1685..1813
                     /gene="Jakmip1"
                     /gene_synonym="Marlin-1; Marlin1"
                     /inference="alignment:Splign:2.1.0"
     exon            1814..1942
                     /gene="Jakmip1"
                     /gene_synonym="Marlin-1; Marlin1"
                     /inference="alignment:Splign:2.1.0"
     exon            1943..2026
                     /gene="Jakmip1"
                     /gene_synonym="Marlin-1; Marlin1"
                     /inference="alignment:Splign:2.1.0"
     exon            2027..2089
                     /gene="Jakmip1"
                     /gene_synonym="Marlin-1; Marlin1"
                     /inference="alignment:Splign:2.1.0"
     exon            2090..2498
                     /gene="Jakmip1"
                     /gene_synonym="Marlin-1; Marlin1"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

agccgctagcgtgcggcgcctgtccccgccgttcccgcatcgtgcacgggttctccgcgggccgagcctcctcggctacggtccaggttttctttattttcattttttgcatgcattcattttctgttctatcttgtcccttttaaggcagcggtgactgggacagcagcgtaggcgcgcgcggggaggaggcggctggagaatgcggctcccggctgctgcccggtttgggtcggagcgtcaagcagactctccagtgatggtgtgcacagaggacgagcggaggcctgcacgactgcttagcacagctgagctggtagctgtgcttgccggtgggcaggcgtgaacctcaggacctcagcgtctcactccaagaggaaacatgtctaaaaagggccgcagcaagggtgagaagcccgagacagagacagactctgtacagatggccaatgaagagctacgggccaagctgacgaacatccagatcgagttccagcaggagaagagcaaggtggggaagctgcgggagcgtctgcaggaggccaagctggaacgggagcaggagcagcgtcgccacacggcctacatctcagaactcaaggccaagctgcacgaagagaagacgaaggaactgcaggcgctgcgcgaggcgctcatccggcagcacgagcaggaggcagcgcggaccgccaagatcaaggaaggcgagctgcagcgactgcaggccacgctgaatgtgctgcgcgatggcgccgcggacaaagtcaagactgcattgctggccgacgcgcgcgaggaggcgcgcaggacctttgatggcgagcgccagaggctgcagcaggagattctggaactgaaggctgcgcgcaaacaggcagaagaggcactcagcaactgcatgcaggcagacaaggccaaagccgcggacctgcgcgctgcgtaccaggcgcaccaggatgaggtgcaccgcatcaagcgggagtgtgaacgtgacatccgcagactgatggacgagatcaaaggaaaggaacgcgtgatcctggccctggagaaggagcttggtgtgcaggccgggcagacccagcggctgctattacagaaggaggctctggatgagcagctggtccaggtcaaggaggccgaacgccaccacagcagcccaaagagggagcttcctccaggcattggtgacatggctgagcttatgggtggccaggatcagcatatggacgagcgagatgtgaggcgatttcagctgaagattgccgaactgaattcagtgattcggaagctggaggacaggaacaccctgctggctgatgagaggaacgaactgctgaagcgctctcgggagacggaggtgcagctgaagccgctggtggagaagaacaaacgcatgaataaaaagaacgaggatctgctgcacagcatccaaaggatggaggagaaactcaagagcctcacgagggaaaacgtggagatgaaagaaaagctgtctgcccaggcctcactaaagcgacacacatccctgaatgacctcagtctgaccagggacgagcaggagatagagttcctgaggctgcaggtgctggaacagcagcatgtcattgatgacctctctctggaaagagaacgcctgctgcgctccaagaggcatcgagggaagagcctgaaaccccccaagaagcatgttgtggagacattttttggatttgatgaggagtctgtggactctgaaacattgtcagagacgtcctacaacacagacaggacagaccggaccccagccacgcctgaagaggacttagatgagaccacaaccagagaagaggctgacctgaggttctgccagctgaccagggagtaccaggctctgcagagggcttatgccctgcttcaggagcaggttggggggacgctggatgctgagagggaggctcggactcgggagcaacttcaggctgacctgctgagatgccaggccaaaattgaggacttagagaagctgctggttgagaagggacaggatgctgcgtgggtagaggagaagcaggtactcatgaggacaaaccaggacctgctggagaagatttacaggctggagatggaggagaaccagctaaagagtgaaatgcaagacgccaaggaccagaacgagctgttagaattcagagtgctagaactcgaagtaagagactctatctgttgtaagctctcaaatggagcagacattctctttgagcccaaactgaaattcgtgtaaagctctctgctatttccaagcatgcgtgaagggacgcgcgttaccgtttctctccttccttcctccgttcttttcctcttcgtctttttaaaaagatctgtatgttcggggtaacttcactgccttaacatgtcctggggaggatgctcgcgacgcctgtggacctgtaccagagcaatcgacttattgcctaccgcttgttttgcacttaataaaataagttgtttttgcaata

//