LOCUS       NM_001271274            1857 bp    mRNA    linear   ROD 30-JUL-2024
DEFINITION  Rattus norvegicus motor neuron and pancreas homeobox 1 (Mnx1),
            mRNA.
ACCESSION   NM_001271274 XM_001059733 XM_003749670
VERSION     NM_001271274.1
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 1857)
  AUTHORS   Desai,S.S., Modali,S.D., Parekh,V.I., Kebebew,E. and Agarwal,S.K.
  TITLE     GSK-3beta protein phosphorylates and stabilizes HLXB9 protein in
            insulinoma cells to form a targetable mechanism of controlling
            insulinoma cell proliferation
  JOURNAL   J Biol Chem 289 (9), 5386-5398 (2014)
   PUBMED   24425879
  REMARK    GeneRIF: Both pHLXB9 and active GSK-3beta are elevated in beta
            cells with menin knockdown, in MEN1-associated beta cell tumors
            (insulinomas)
REFERENCE   2  (bases 1 to 1857)
  AUTHORS   Kelly,C.E., Thymiakou,E., Dixon,J.E., Tanaka,S., Godwin,J. and
            Episkopou,V.
  TITLE     Rnf165/Ark2C enhances BMP-Smad signaling to mediate motor axon
            extension
  JOURNAL   PLoS Biol 11 (4), e1001538 (2013)
   PUBMED   23610558
REFERENCE   3  (bases 1 to 1857)
  AUTHORS   Cho,A., Ko,H.W. and Eggenschwiler,J.T.
  TITLE     FKBP8 cell-autonomously controls neural tube patterning through a
            Gli2- and Kif3a-dependent mechanism
  JOURNAL   Dev Biol 321 (1), 27-39 (2008)
   PUBMED   18590716
REFERENCE   4  (bases 1 to 1857)
  AUTHORS   Lee,S., Lee,B., Joshi,K., Pfaff,S.L., Lee,J.W. and Lee,S.K.
  TITLE     A regulatory network to segregate the identity of neuronal subtypes
  JOURNAL   Dev Cell 14 (6), 877-889 (2008)
   PUBMED   18539116
REFERENCE   5  (bases 1 to 1857)
  AUTHORS   Winseck,A.K. and Oppenheim,R.W.
  TITLE     An in vivo analysis of Schwann cell programmed cell death in
            embryonic mice: the role of axons, glial growth factor, and the
            pro-apoptotic gene Bax
  JOURNAL   Eur J Neurosci 24 (8), 2105-2117 (2006)
   PUBMED   17042795
REFERENCE   6  (bases 1 to 1857)
  AUTHORS   Yang,X., Arber,S., William,C., Li,L., Tanabe,Y., Jessell,T.M.,
            Birchmeier,C. and Burden,S.J.
  TITLE     Patterning of muscle acetylcholine receptor gene expression in the
            absence of motor innervation
  JOURNAL   Neuron 30 (2), 399-410 (2001)
   PUBMED   11395002
REFERENCE   7  (bases 1 to 1857)
  AUTHORS   Li,H., Arber,S., Jessell,T.M. and Edlund,H.
  TITLE     Selective agenesis of the dorsal pancreas in mice lacking homeobox
            gene Hlxb9
  JOURNAL   Nat Genet 23 (1), 67-70 (1999)
   PUBMED   10471501
REFERENCE   8  (bases 1 to 1857)
  AUTHORS   Arber,S., Han,B., Mendelsohn,M., Smith,M., Jessell,T.M. and
            Sockanathan,S.
  TITLE     Requirement for the homeobox gene Hb9 in the consolidation of motor
            neuron identity
  JOURNAL   Neuron 23 (4), 659-674 (1999)
   PUBMED   10482234
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from CH474057.1.
            
            On or before Sep 13, 2012 this sequence version replaced
            XM_001059733.1, XM_003749670.1.
            
            ##Evidence-Data-START##
            RNAseq introns :: single sample supports all introns SAMEA5760434,
                              SAMN12840114 [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..1857
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /db_xref="taxon:10116"
                     /chromosome="4"
                     /map="4q11"
     gene            1..1857
                     /gene="Mnx1"
                     /gene_synonym="Hlxb9"
                     /note="motor neuron and pancreas homeobox 1"
                     /db_xref="GeneID:682076"
                     /db_xref="RGD:1588091"
     exon            1..728
                     /gene="Mnx1"
                     /gene_synonym="Hlxb9"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    14..16
                     /gene="Mnx1"
                     /gene_synonym="Hlxb9"
                     /note="upstream in-frame stop codon"
     CDS             38..1249
                     /gene="Mnx1"
                     /gene_synonym="Hlxb9"
                     /note="homeobox gene HB9; motor neuron and pancreas
                     homeobox protein 1; homeobox protein HB9"
                     /codon_start=1
                     /product="motor neuron and pancreas homeobox 1"
                     /protein_id="NP_001258203.1"
                     /db_xref="GeneID:682076"
                     /db_xref="RGD:1588091"
                     /translation="

MEKSKNFRIDALLAVDPPRAASTQSAPLALVTSLAATPSGPGRGGSGGGGTSSGASRSCSPASSEATAAPGDRLRAESPSPPRLLTAHCALLPKPGFLGAGGGGGAAGGPGTPHHHAHPGAAAAAAAAAAAAAAGGLALGLHPGGAQGGAGLPAQAALYGHPVYSYSAAAAAAALAGQHPALSYSYPQVQGAHPAHPADPIKLGAGTFQLDQWLRASTAGMILPKMPDFSSQAQSNLLGKCRRPRTAFTSQQLLELEHQFKLNKYLSRPKRFEVATSLMLTETQVKIWFQNRRMKWKRSKKAKEQAAQEAEKQKGSGGGAGKGGTEEKTEEELLGPPVSGDKASGRRLRDLRDSDPDEDEDDEEDHFPYSNGVGAHAASSDCSSEDDSPPPRPGGPGHQPLPQ"

     misc_feature    38..40
                     /gene="Mnx1"
                     /gene_synonym="Hlxb9"
                     /note="N-acetylmethionine.
                     /evidence=ECO:0000250|UniProtKB:P50219; propagated from
                     UniProtKB/Swiss-Prot (M0R6D8.2); acetylation site"
     misc_feature    131..280
                     /gene="Mnx1"
                     /gene_synonym="Hlxb9"
                     /note="propagated from UniProtKB/Swiss-Prot (M0R6D8.2);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    269..271
                     /gene="Mnx1"
                     /gene_synonym="Hlxb9"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P50219; propagated from
                     UniProtKB/Swiss-Prot (M0R6D8.2); phosphorylation site"
     misc_feature    275..277
                     /gene="Mnx1"
                     /gene_synonym="Hlxb9"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P50219; propagated from
                     UniProtKB/Swiss-Prot (M0R6D8.2); phosphorylation site"
     misc_feature    761..931
                     /gene="Mnx1"
                     /gene_synonym="Hlxb9"
                     /note="Region: Homeodomain; pfam00046"
                     /db_xref="CDD:459649"
     misc_feature    932..1246
                     /gene="Mnx1"
                     /gene_synonym="Hlxb9"
                     /note="propagated from UniProtKB/Swiss-Prot (M0R6D8.2);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     exon            729..889
                     /gene="Mnx1"
                     /gene_synonym="Hlxb9"
                     /inference="alignment:Splign:2.1.0"
     exon            890..1857
                     /gene="Mnx1"
                     /gene_synonym="Hlxb9"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

cacccttgggccctgatcgtcagctccaaacgagccgatggaaaaatccaaaaatttccgcatcgacgccttgctggcggtggatcccccgcgagccgcctccacgcagagcgcgcctctggccttggtcacttccctcgccgctacaccatctggtcccggccgcggcggtagcggtggcgggggaaccagtagcggggcgagccgcagctgcagtcccgcgtcctcggaggccaccgcagcacccggtgatagactgagggctgagagcccgtcgcctccgcgcttgctgactgcacactgcgcgctgctgcccaagcctggatttctaggcgccgggggaggcggcggcgcggcgggtgggccgggcactccacaccaccacgcgcaccctggtgccgccgccgccgccgctgctgccgcggctgccgccgcagccgggggcctggcactggggctgcaccccgggggcgcacagggcggcgcgggcctcccggcacaggcagctctctacggacacccggtctacagttactcggcagcagctgcagcggccgcgctagctggccagcacccggcgctttcctactcgtatcctcaggtgcagggcgcgcaccctgctcaccctgccgaccccatcaagctgggtgccggcacctttcaactggaccagtggctgcgcgcgtctactgcgggcatgatcctgcccaagatgccggacttcagctcccaggcgcaatcgaacctcttggggaagtgccgaaggcctcgcacggccttcaccagccagcagctgttggagctggaacaccagttcaagctcaacaagtacctgtcgcgacccaagcgttttgaggtggctacctcgctcatgctcaccgagacccaggtgaagatttggttccagaaccgccgaatgaaatggaaacgcagcaaaaaggccaaagagcaggctgcgcaggaggcagagaagcagaagggcagcggcgggggcgccggcaaaggcggcactgaggagaagacggaggaggagctgctgggacctccagtttcgggggacaaggccagcggccgtcgcctgcgggacttgcgggacagtgacccagatgaggatgaggatgatgaagaagaccacttcccctacagcaatggggtcggtgcccacgctgcctcatccgattgctcatctgaggacgactcgcctcccccaaggccaggagggcccgggcaccaacctctgccccagtagttgtcccaaaggcggcagcaggaatgtgcaaaatggcgacctgggacctgggctgcgggggttcaaacttcatccagtggcctgcagccaggctgacagcctctccccggactatgtatgcatccaggtgtgggctggagtgcgaatactttttggaccctcgaaggacagcaagagagaatgaaagaggggctccaatgtgaactttcgttcttttacatttaatttcgggtcatgttggccagaggtgtttgtgagaagaatctaccctttctaggagtggctcctgcctgactcttctctcatcaaagaaaggggaaaaaatgacagtgttaagtgacctagaaacttgaacccgccattggagacaaccattctgttgagaattgaaaacacaggttgaataaaggtgttatgcctatgtatgggatagggtgggatggggtggggtgttatggcatgagcattcagattgctgcaaaatctcagaatggtagtgtatttttgtatattgtatttatatataaagaaagaaacgtctacttatgcatgctaaattattatttagctttcccgttccccaggatagagatgaaatgtaaaataaa

//