GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-11-23 11:07:04, GGRNA.v2 : RefSeq release 226 (Sep, 2024)

LOCUS       NM_001129878            2253 bp    mRNA    linear   ROD 21-MAR-2023
DEFINITION  Rattus norvegicus homeobox A11 (Hoxa11), mRNA.
ACCESSION   NM_001129878 XM_001059505
VERSION     NM_001129878.1
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 2253)
  AUTHORS   Raines AM, Adam M, Magella B, Meyer SE, Grimes HL, Dey SK and
            Potter SS.
  TITLE     Recombineering-based dissection of flanking and paralogous Hox gene
            functions in mouse reproductive tracts
  JOURNAL   Development 140 (14), 2942-2952 (2013)
   PUBMED   23760953
REFERENCE   2  (bases 1 to 2253)
  AUTHORS   Gross S, Krause Y, Wuelling M and Vortkamp A.
  TITLE     Hoxa11 and Hoxd11 regulate chondrocyte differentiation upstream of
            Runx2 and Shox2 in mice
  JOURNAL   PLoS One 7 (8), e43553 (2012)
   PUBMED   22916278
REFERENCE   3  (bases 1 to 2253)
  AUTHORS   Koyama E, Yasuda T, Minugh-Purvis N, Kinumatsu T, Yallowitz AR,
            Wellik DM and Pacifici M.
  TITLE     Hox11 genes establish synovial joint organization and phylogenetic
            characteristics in developing mouse zeugopod skeletal elements
  JOURNAL   Development 137 (22), 3795-3800 (2010)
   PUBMED   20978074
REFERENCE   4  (bases 1 to 2253)
  AUTHORS   Hassan MQ, Saini S, Gordon JA, van Wijnen AJ, Montecino M, Stein
            JL, Stein GS and Lian JB.
  TITLE     Molecular switches involving homeodomain proteins, HOXA10 and RUNX2
            regulate osteoblastogenesis
  JOURNAL   Cells Tissues Organs 189 (1-4), 122-125 (2009)
   PUBMED   18701816
  REMARK    GeneRIF: This study shows selective association of HOXA10, MSX2,
            DLX3 and DLX5 homeodomain transcription factors on Runx2 and OC
            genes at stages of osteoblast maturation and participation of these
            factors with RUNX2 in chromatin remodeling of bone-specific genes.
REFERENCE   5  (bases 1 to 2253)
  AUTHORS   Varayoud J, Ramos JG, Bosquiazzo VL, Munoz-de-Toro M and Luque EH.
  TITLE     Developmental exposure to Bisphenol a impairs the uterine response
            to ovarian steroids in the adult
  JOURNAL   Endocrinology 149 (11), 5848-5860 (2008)
   PUBMED   18653720
REFERENCE   6  (bases 1 to 2253)
  AUTHORS   Thompson AA and Nguyen LT.
  TITLE     Amegakaryocytic thrombocytopenia and radio-ulnar synostosis are
            associated with HOXA11 mutation
  JOURNAL   Nat Genet 26 (4), 397-398 (2000)
   PUBMED   11101832
REFERENCE   7  (bases 1 to 2253)
  AUTHORS   Shen WF, Montgomery JC, Rozenfeld S, Moskow JJ, Lawrence HJ,
            Buchberg AM and Largman C.
  TITLE     AbdB-like Hox proteins stabilize DNA binding by the Meis1
            homeodomain proteins
  JOURNAL   Mol Cell Biol 17 (11), 6448-6458 (1997)
   PUBMED   9343407
REFERENCE   8  (bases 1 to 2253)
  AUTHORS   Davis AP, Witte DP, Hsieh-Li HM, Potter SS and Capecchi MR.
  TITLE     Absence of radius and ulna in mice lacking hoxa-11 and hoxd-11
  JOURNAL   Nature 375 (6534), 791-795 (1995)
   PUBMED   7596412
REFERENCE   9  (bases 1 to 2253)
  AUTHORS   Hsieh-Li HM, Witte DP, Weinstein M, Branford W, Li H, Small K and
            Potter SS.
  TITLE     Hoxa 11 structure, extensive antisense transcription, and function
            in male and female fertility
  JOURNAL   Development 121 (5), 1373-1385 (1995)
   PUBMED   7789268
REFERENCE   10 (bases 1 to 2253)
  AUTHORS   Sakoyama Y, Mizuta I, Ogasawara N and Yoshikawa H.
  TITLE     Cloning of rat homeobox genes
  JOURNAL   Biochem Genet 32 (9-10), 351-360 (1994)
   PUBMED   7702549
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from CH474011.2.
            
            On Jul 10, 2008 this sequence version replaced XM_001059505.1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            RNAseq introns :: single sample supports all introns SAMEA5760384,
                              SAMEA5760386 [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..2253
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /db_xref="taxon:10116"
                     /chromosome="4"
                     /map="4q24"
     gene            1..2253
                     /gene="Hoxa11"
                     /gene_synonym="Hoxa10; RGD1564605; RGD1566402"
                     /note="homeobox A11"
                     /db_xref="GeneID:103692131"
                     /db_xref="RGD:1564605"
     exon            1..757
                     /gene="Hoxa11"
                     /gene_synonym="Hoxa10; RGD1564605; RGD1566402"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    13..15
                     /gene="Hoxa11"
                     /gene_synonym="Hoxa10; RGD1564605; RGD1566402"
                     /note="upstream in-frame stop codon"
     CDS             49..990
                     /gene="Hoxa11"
                     /gene_synonym="Hoxa10; RGD1564605; RGD1566402"
                     /note="homeobox protein Hox-A11-like; homeobox protein
                     A10; homeo box A10"
                     /codon_start=1
                     /product="homeobox protein Hox-A11"
                     /protein_id="NP_001123350.1"
                     /db_xref="GeneID:103692131"
                     /db_xref="RGD:1564605"
                     /translation="
MMDFDERGPCSSNMYLPSCTYYVSGPDFSSLPSFLPQTPSSRPMTYSYSSNLPQVQPVREVTFREYAIEPATKWHPRGNLAHCYSAEELVHRDCLQAPSAAGVPGDVLAKSSANVYHHPTPAVSSNFYSTVGRNGVLPQAFDQFFETAYGTPENLASSDYPGDKNAEKGPPTAAATSAAAVAAAATGAPATSSSDGGGGGGCQEAAAEEKERRRRPESSSSPESSSGHTEDKAGGSGGQRTRKKRCPYTKYQIRELEREFFFSVYINKEKRLQLSRMLNLTDRQVKIWFQNRRMKEKKINRDRLQYYSANPLL"
     misc_feature    124..510
                     /gene="Hoxa11"
                     /gene_synonym="Hoxa10; RGD1564605; RGD1566402"
                     /note="Protein of unknown function (DUF3528); Region:
                     DUF3528; pfam12045"
                     /db_xref="CDD:432284"
     misc_feature    772..942
                     /gene="Hoxa11"
                     /gene_synonym="Hoxa10; RGD1564605; RGD1566402"
                     /note="Region: Homeodomain; pfam00046"
                     /db_xref="CDD:459649"
     exon            758..2253
                     /gene="Hoxa11"
                     /gene_synonym="Hoxa10; RGD1564605; RGD1566402"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
ggagaatcatgttaagctcggctactgcggagagcccaaggtagcccaatgatggattttgatgagcgtggtccctgctcctctaacatgtatttgccaagttgtacttactacgtctcgggtccagatttctccagcctcccttcttttttgccccagaccccgtcttcgcgcccaatgacatactcctactcctccaacctgccccaggtccaacccgtgcgcgaagtgaccttcagagaatacgccattgagcccgccactaaatggcacccccgcggcaatctggcccactgctactccgcggaggagctcgtgcacagagactgtctgcaggcgcccagcgcggccggcgtgcctggcgacgtgctggccaagagctcggccaacgtctaccaccaccccacccccgccgtctcgtccaatttctatagcacggtgggcaggaacggcgttctgccacaggctttcgaccagtttttcgagacggcttacggcaccccggaaaacctcgcttcctccgactaccctggggacaagaacgccgagaaagggcccccaacagcagctgcgacctccgctgcggcggtggcggcggcggccaccggcgcgccggcaacttcaagttcggacggcggtggcggcggcggctgtcaggaggcggcggcggaggagaaggagcggcggcggcgacccgagagcagcagcagccccgagtcgtcttccggccacactgaggacaaggccggtggctccggtggccaacgcacccgcaaaaagcgctgcccttataccaaataccagatccgagagctggagcgagagttcttcttcagcgtctacatcaacaaagagaagcgtctgcaactgtcccgtatgctcaacctcaccgaccgtcaagtcaaaatctggtttcagaacagaagaatgaaggaaaaaaagattaacagagaccggttacagtactactcagctaatccacttctctaaggcccccgcctactggaattgggagagggcttcatacatgtgaaataatatgcagattttgcccttgacaaggtcaagccacattgtgacttggaaaagggggggggtgatataggagagaggggaggcttcctttgcagagatagcccaataggaaggggcctgaaactctcttggttcagatctccatggctaagcttcctaataattggattctaagagttgtgaatcaacagaatgaatggtttgggaccccctgatggttcactcttagagcctgcaaaagctttgggctgggtgtggtcactggggattgggccccctgccaagccctatggaggccacccgctcaagaccctctgcacagagcctgcccacccccaggtctccccaatcaagaaattgtatgccccaagcctagttcagcttggggataggggtaggcggaaaggggaagattcctagagatccagaatggggttgttttccaaacgtaatgtgaaagacagttgaactaaaaggtggctgtgaaatgggagagagctgggggccctggaggaatgaaaaatctatccagatgacgttaatatctttccatcccgcctagctaccactgatctgcacccaaacctgagctcctagcagccaccttttgcagcccacctgggtcttctacctcccaatggtggtgatgggtcttcattcaggccccatctcagaactgacaattcctggggtagaagacattgagaaatccagaggttttgctggttgctggcccctcaatctctacaggaaatgcctgtggagttctacagtttggcaaactctccaccacattaaggaagcttggatttggtgtatgtaaggcagcagagcagtaaacctggccagtggctccttggcctttggctatgaggggctgaagtctccccacttcccaactcccccatccctacgctgcactctgtgctcattgactcagaactgagcttgggagcttctggcaatcttctaagagccggagaatgatttggagttattttaaaagataaatattatattatatatatatttccccgaaggaaccaaagcgaattttaagatgcaatgtagaggggggtggggataataaaatatttaaaggctctatctgtttacagtgttccaaggtttaaactcgctcactgctaaaatatttgaatgtatgcttcatacagggatggtgttcaaaagacttgtaaataaagaaatcataaccta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]