GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-11-23 10:34:29, GGRNA.v2 : RefSeq release 226 (Sep, 2024)

LOCUS       NM_001109106            1148 bp    mRNA    linear   ROD 21-MAR-2023
DEFINITION  Rattus norvegicus HESX homeobox 1 (Hesx1), mRNA.
ACCESSION   NM_001109106 XM_001057775 XM_573850
VERSION     NM_001109106.1
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 1148)
  AUTHORS   Takagi M, Takahashi M, Ohtsu Y, Sato T, Narumi S, Arakawa H and
            Hasegawa T.
  TITLE     A novel mutation in HESX1 causes combined pituitary hormone
            deficiency without septo optic dysplasia phenotypes
  JOURNAL   Endocr J 63 (4), 405-410 (2016)
   PUBMED   26781211
REFERENCE   2  (bases 1 to 1148)
  AUTHORS   Sajedi E, Gaston-Massuet C, Andoniadou CL, Signore M, Hurd PJ,
            Dattani M and Martinez-Barbera JP.
  TITLE     DNMT1 interacts with the developmental transcriptional repressor
            HESX1
  JOURNAL   Biochim Biophys Acta 1783 (1), 131-143 (2008)
   PUBMED   17931718
REFERENCE   3  (bases 1 to 1148)
  AUTHORS   Susa T, Nakayama M, Kitahara K, Kimoto F, Kato T and Kato Y.
  TITLE     Homeodomain transcription factor Hesx1/Rpx occupies Prop-1
            activation sites in porcine follicle stimulating hormone (FSH) beta
            subunit promoter
  JOURNAL   Biochem Biophys Res Commun 357 (3), 712-717 (2007)
   PUBMED   17445765
REFERENCE   4  (bases 1 to 1148)
  AUTHORS   Olson LE, Tollkuhn J, Scafoglio C, Krones A, Zhang J, Ohgi KA, Wu
            W, Taketo MM, Kemler R, Grosschedl R, Rose D, Li X and Rosenfeld
            MG.
  TITLE     Homeodomain-mediated beta-catenin-dependent switching events
            dictate cell-lineage determination
  JOURNAL   Cell 125 (3), 593-605 (2006)
   PUBMED   16678101
REFERENCE   5  (bases 1 to 1148)
  AUTHORS   Brickman JM, Clements M, Tyrell R, McNay D, Woods K, Warner J,
            Stewart A, Beddington RS and Dattani M.
  TITLE     Molecular effects of novel mutations in Hesx1/HESX1 associated with
            human pituitary disorders
  JOURNAL   Development 128 (24), 5189-5199 (2001)
   PUBMED   11748154
REFERENCE   6  (bases 1 to 1148)
  AUTHORS   Martinez-Barbera JP and Beddington RS.
  TITLE     Getting your head around Hex and Hesx1: forebrain formation in
            mouse
  JOURNAL   Int J Dev Biol 45 (1), 327-336 (2001)
   PUBMED   11291863
REFERENCE   7  (bases 1 to 1148)
  AUTHORS   Martinez-Barbera JP, Rodriguez TA and Beddington RS.
  TITLE     The homeobox gene Hesx1 is required in the anterior neural ectoderm
            for normal forebrain formation
  JOURNAL   Dev Biol 223 (2), 422-430 (2000)
   PUBMED   10882526
REFERENCE   8  (bases 1 to 1148)
  AUTHORS   Dattani MT, Martinez-Barbera JP, Thomas PQ, Brickman JM, Gupta R,
            Martensson IL, Toresson H, Fox M, Wales JK, Hindmarsh PC, Krauss S,
            Beddington RS and Robinson IC.
  TITLE     Mutations in the homeobox gene HESX1/Hesx1 associated with
            septo-optic dysplasia in human and mouse
  JOURNAL   Nat Genet 19 (2), 125-133 (1998)
   PUBMED   9620767
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from CH474067.2.
            
            On or before Oct 4, 2007 this sequence version replaced
            XM_573850.2, XM_001057775.1.
            
            ##Evidence-Data-START##
            RNAseq introns :: single sample supports all introns SAMEA5760383
                              [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..1148
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /db_xref="taxon:10116"
                     /chromosome="16"
                     /map="16p16"
     gene            1..1148
                     /gene="Hesx1"
                     /gene_synonym="RGD1563858"
                     /note="HESX homeobox 1"
                     /db_xref="GeneID:498575"
                     /db_xref="RGD:1563858"
     exon            1..515
                     /gene="Hesx1"
                     /gene_synonym="RGD1563858"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    287..289
                     /gene="Hesx1"
                     /gene_synonym="RGD1563858"
                     /note="upstream in-frame stop codon"
     CDS             359..916
                     /gene="Hesx1"
                     /gene_synonym="RGD1563858"
                     /note="homeo box gene expressed in ES cells"
                     /codon_start=1
                     /product="homeobox expressed in ES cells 1"
                     /protein_id="NP_001102576.1"
                     /db_xref="GeneID:498575"
                     /db_xref="RGD:1563858"
                     /translation="
MSPSLREVAQLRESKPSPCSFSIESILGLDQKKDCATSVRPHRPWTDTCGDSEKDGNPRLHAPGLPSEISFPCPVDHPMPEERAPKYENYFSASETHSLKRELSWYRGRRPRTAFTQNQVEVLENVFRMNCYPGIDIREDLAQKLNLEEDRIQIWFQNRRAKLKRSRRESQFLMAKKPFNPDLLK"
     misc_feature    683..853
                     /gene="Hesx1"
                     /gene_synonym="RGD1563858"
                     /note="Region: Homeodomain; pfam00046"
                     /db_xref="CDD:459649"
     exon            516..715
                     /gene="Hesx1"
                     /gene_synonym="RGD1563858"
                     /inference="alignment:Splign:2.1.0"
     exon            716..817
                     /gene="Hesx1"
                     /gene_synonym="RGD1563858"
                     /inference="alignment:Splign:2.1.0"
     exon            818..1148
                     /gene="Hesx1"
                     /gene_synonym="RGD1563858"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
gattttatacattaatggtctcaaataaaagaggagtgccgtgtttgtgcatcacttctttcaagaaagttaagtctgtgttctgcttaggagagataacactttttgtccctgtaggtggccccctggtgtagccattagttgctaattacttgcaaacaaataaacaattaactccttaagctgctggctgggcaagtgttcattgacttgctaaaactttctaaaacgggattttaattagtgacgttggaaacccggccccctagccagcgaagctacaaggtgaactgctggaagatcccggctttgcacacgtggggcaggagccctccagctctgtacgacccagaagaggatgtctcccagccttcgggaagttgctcagctccgggaaagcaaaccctcaccctgctccttctcaatcgagagcattttaggactggaccagaaaaaagattgcgcaacgtcagtaagaccccacagaccctggacagacacctgcggcgactcagagaaagacggtaacccacgtctacatgccccaggtcttcccagtgagatttcatttccttgtccagtggatcacccaatgcctgaagaaagggctcccaaatatgaaaattacttttcagcctcagaaacacactctttgaaaagagagttgagttggtacagaggacgaaggccaagaaccgcttttacacagaaccaggtcgaagtactagaaaatgtcttcagaatgaactgctatcctggcattgatatcagagaggacctagctcaaaagctgaatttagaggaggacagaatccagatttggttccaaaaccgtcgagcaaagctgaaaaggtcccggagagaatcacagtttctaatggcaaaaaagcccttcaatccagatcttctgaaataggtagaaaattatacatgtgggcttctcttccagttgtagaatgcaagaaatctatggaaataccacgtacttaaaatgttatggtttctctcctgtgcctaatccggatattgtcattctttgtgaaaatattgcaaataattatgattctagcacagtacatgttataactggacattttttagttataatgaaaacccctttcctatatatttttaataaacattttcag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]