2024-11-23 10:34:29, GGRNA.v2 : RefSeq release 226 (Sep, 2024)
LOCUS NM_001109106 1148 bp mRNA linear ROD 21-MAR-2023 DEFINITION Rattus norvegicus HESX homeobox 1 (Hesx1), mRNA. ACCESSION NM_001109106 XM_001057775 XM_573850 VERSION NM_001109106.1 KEYWORDS RefSeq; RefSeq Select. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 1148) AUTHORS Takagi M, Takahashi M, Ohtsu Y, Sato T, Narumi S, Arakawa H and Hasegawa T. TITLE A novel mutation in HESX1 causes combined pituitary hormone deficiency without septo optic dysplasia phenotypes JOURNAL Endocr J 63 (4), 405-410 (2016) PUBMED 26781211 REFERENCE 2 (bases 1 to 1148) AUTHORS Sajedi E, Gaston-Massuet C, Andoniadou CL, Signore M, Hurd PJ, Dattani M and Martinez-Barbera JP. TITLE DNMT1 interacts with the developmental transcriptional repressor HESX1 JOURNAL Biochim Biophys Acta 1783 (1), 131-143 (2008) PUBMED 17931718 REFERENCE 3 (bases 1 to 1148) AUTHORS Susa T, Nakayama M, Kitahara K, Kimoto F, Kato T and Kato Y. TITLE Homeodomain transcription factor Hesx1/Rpx occupies Prop-1 activation sites in porcine follicle stimulating hormone (FSH) beta subunit promoter JOURNAL Biochem Biophys Res Commun 357 (3), 712-717 (2007) PUBMED 17445765 REFERENCE 4 (bases 1 to 1148) AUTHORS Olson LE, Tollkuhn J, Scafoglio C, Krones A, Zhang J, Ohgi KA, Wu W, Taketo MM, Kemler R, Grosschedl R, Rose D, Li X and Rosenfeld MG. TITLE Homeodomain-mediated beta-catenin-dependent switching events dictate cell-lineage determination JOURNAL Cell 125 (3), 593-605 (2006) PUBMED 16678101 REFERENCE 5 (bases 1 to 1148) AUTHORS Brickman JM, Clements M, Tyrell R, McNay D, Woods K, Warner J, Stewart A, Beddington RS and Dattani M. TITLE Molecular effects of novel mutations in Hesx1/HESX1 associated with human pituitary disorders JOURNAL Development 128 (24), 5189-5199 (2001) PUBMED 11748154 REFERENCE 6 (bases 1 to 1148) AUTHORS Martinez-Barbera JP and Beddington RS. TITLE Getting your head around Hex and Hesx1: forebrain formation in mouse JOURNAL Int J Dev Biol 45 (1), 327-336 (2001) PUBMED 11291863 REFERENCE 7 (bases 1 to 1148) AUTHORS Martinez-Barbera JP, Rodriguez TA and Beddington RS. TITLE The homeobox gene Hesx1 is required in the anterior neural ectoderm for normal forebrain formation JOURNAL Dev Biol 223 (2), 422-430 (2000) PUBMED 10882526 REFERENCE 8 (bases 1 to 1148) AUTHORS Dattani MT, Martinez-Barbera JP, Thomas PQ, Brickman JM, Gupta R, Martensson IL, Toresson H, Fox M, Wales JK, Hindmarsh PC, Krauss S, Beddington RS and Robinson IC. TITLE Mutations in the homeobox gene HESX1/Hesx1 associated with septo-optic dysplasia in human and mouse JOURNAL Nat Genet 19 (2), 125-133 (1998) PUBMED 9620767 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from CH474067.2. On or before Oct 4, 2007 this sequence version replaced XM_573850.2, XM_001057775.1. ##Evidence-Data-START## RNAseq introns :: single sample supports all introns SAMEA5760383 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on single protein-coding transcript ##RefSeq-Attributes-END## FEATURES Location/Qualifiers source 1..1148 /organism="Rattus norvegicus" /mol_type="mRNA" /db_xref="taxon:10116" /chromosome="16" /map="16p16" gene 1..1148 /gene="Hesx1" /gene_synonym="RGD1563858" /note="HESX homeobox 1" /db_xref="GeneID:498575" /db_xref="RGD:1563858" exon 1..515 /gene="Hesx1" /gene_synonym="RGD1563858" /inference="alignment:Splign:2.1.0" misc_feature 287..289 /gene="Hesx1" /gene_synonym="RGD1563858" /note="upstream in-frame stop codon" CDS 359..916 /gene="Hesx1" /gene_synonym="RGD1563858" /note="homeo box gene expressed in ES cells" /codon_start=1 /product="homeobox expressed in ES cells 1" /protein_id="NP_001102576.1" /db_xref="GeneID:498575" /db_xref="RGD:1563858" /translation="
MSPSLREVAQLRESKPSPCSFSIESILGLDQKKDCATSVRPHRPWTDTCGDSEKDGNPRLHAPGLPSEISFPCPVDHPMPEERAPKYENYFSASETHSLKRELSWYRGRRPRTAFTQNQVEVLENVFRMNCYPGIDIREDLAQKLNLEEDRIQIWFQNRRAKLKRSRRESQFLMAKKPFNPDLLK"
misc_feature 683..853 /gene="Hesx1" /gene_synonym="RGD1563858" /note="Region: Homeodomain; pfam00046" /db_xref="CDD:459649" exon 516..715 /gene="Hesx1" /gene_synonym="RGD1563858" /inference="alignment:Splign:2.1.0" exon 716..817 /gene="Hesx1" /gene_synonym="RGD1563858" /inference="alignment:Splign:2.1.0" exon 818..1148 /gene="Hesx1" /gene_synonym="RGD1563858" /inference="alignment:Splign:2.1.0" ORIGIN
gattttatacattaatggtctcaaataaaagaggagtgccgtgtttgtgcatcacttctttcaagaaagttaagtctgtgttctgcttaggagagataacactttttgtccctgtaggtggccccctggtgtagccattagttgctaattacttgcaaacaaataaacaattaactccttaagctgctggctgggcaagtgttcattgacttgctaaaactttctaaaacgggattttaattagtgacgttggaaacccggccccctagccagcgaagctacaaggtgaactgctggaagatcccggctttgcacacgtggggcaggagccctccagctctgtacgacccagaagaggatgtctcccagccttcgggaagttgctcagctccgggaaagcaaaccctcaccctgctccttctcaatcgagagcattttaggactggaccagaaaaaagattgcgcaacgtcagtaagaccccacagaccctggacagacacctgcggcgactcagagaaagacggtaacccacgtctacatgccccaggtcttcccagtgagatttcatttccttgtccagtggatcacccaatgcctgaagaaagggctcccaaatatgaaaattacttttcagcctcagaaacacactctttgaaaagagagttgagttggtacagaggacgaaggccaagaaccgcttttacacagaaccaggtcgaagtactagaaaatgtcttcagaatgaactgctatcctggcattgatatcagagaggacctagctcaaaagctgaatttagaggaggacagaatccagatttggttccaaaaccgtcgagcaaagctgaaaaggtcccggagagaatcacagtttctaatggcaaaaaagcccttcaatccagatcttctgaaataggtagaaaattatacatgtgggcttctcttccagttgtagaatgcaagaaatctatggaaataccacgtacttaaaatgttatggtttctctcctgtgcctaatccggatattgtcattctttgtgaaaatattgcaaataattatgattctagcacagtacatgttataactggacattttttagttataatgaaaacccctttcctatatatttttaataaacattttcag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]