LOCUS       NM_001107594            1472 bp    mRNA    linear   ROD 20-MAR-2023
DEFINITION  Rattus norvegicus NK2 homeobox 3 (Nkx2-3), mRNA.
ACCESSION   NM_001107594 XM_001056222 XM_219880
VERSION     NM_001107594.1
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 1472)
  AUTHORS   Zheng H, Zhai W, Zhong C, Hong Q, Li H, Rui B, Zhu X, Que D, Feng
            L, Yu B, Huang G, Yin J, Li J, Yan J and Yang P.
  TITLE     Nkx2-3 induces autophagy inhibiting proliferation and migration of
            vascular smooth muscle cells via AMPK/mTOR signaling pathway
  JOURNAL   J Cell Physiol 236 (11), 7342-7355 (2021)
   PUBMED   33928642
  REMARK    GeneRIF: Nkx2-3 induces autophagy inhibiting proliferation and
            migration of vascular smooth muscle cells via AMPK/mTOR signaling
            pathway.
REFERENCE   2  (bases 1 to 1472)
  AUTHORS   Tarlinton D, Light A, Metcalf D, Harvey RP and Robb L.
  TITLE     Architectural defects in the spleens of Nkx2-3-deficient mice are
            intrinsic and associated with defects in both B cell maturation and
            T cell-dependent immune responses
  JOURNAL   J Immunol 170 (8), 4002-4010 (2003)
   PUBMED   12682228
REFERENCE   3  (bases 1 to 1472)
  AUTHORS   Biben C, Wang CC and Harvey RP.
  TITLE     NK-2 class homeobox genes and pharyngeal/oral patterning: Nkx2-3 is
            required for salivary gland and tooth morphogenesis
  JOURNAL   Int J Dev Biol 46 (4), 415-422 (2002)
   PUBMED   12141427
REFERENCE   4  (bases 1 to 1472)
  AUTHORS   Wang CC, Biben C, Robb L, Nassir F, Barnett L, Davidson NO,
            Koentgen F, Tarlinton D and Harvey RP.
  TITLE     Homeodomain factor Nkx2-3 controls regional expression of leukocyte
            homing coreceptor MAdCAM-1 in specialized endothelial cells of the
            viscera
  JOURNAL   Dev Biol 224 (2), 152-167 (2000)
   PUBMED   10926756
REFERENCE   5  (bases 1 to 1472)
  AUTHORS   Pabst O, Forster R, Lipp M, Engel H and Arnold HH.
  TITLE     NKX2.3 is required for MAdCAM-1 expression and homing of
            lymphocytes in spleen and mucosa-associated lymphoid tissue
  JOURNAL   EMBO J 19 (9), 2015-2023 (2000)
   PUBMED   10790368
REFERENCE   6  (bases 1 to 1472)
  AUTHORS   Pabst O, Zweigerdt R and Arnold HH.
  TITLE     Targeted disruption of the homeobox transcription factor Nkx2-3 in
            mice results in postnatal lethality and abnormal development of
            small intestine and spleen
  JOURNAL   Development 126 (10), 2215-2225 (1999)
   PUBMED   10207146
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from CH473986.1.
            
            On or before Oct 4, 2007 this sequence version replaced
            XM_001056222.1, XM_219880.4.
            
            ##Evidence-Data-START##
            RNAseq introns :: single sample supports all introns SAMN11044071,
                              SAMN12840112 [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..1472
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /db_xref="taxon:10116"
                     /chromosome="1"
                     /map="1q54"
     gene            1..1472
                     /gene="Nkx2-3"
                     /note="NK2 homeobox 3"
                     /db_xref="GeneID:309389"
                     /db_xref="RGD:1308521"
     exon            1..350
                     /gene="Nkx2-3"
                     /inference="alignment:Splign:2.1.0"
     CDS             2..1090
                     /gene="Nkx2-3"
                     /codon_start=1
                     /product="homeobox protein Nkx-2.3"
                     /protein_id="NP_001101064.1"
                     /db_xref="GeneID:309389"
                     /db_xref="RGD:1308521"
                     /translation="

MMIPSPVTSTPFSVKDILNLEQQRHFHGAHLQAELEQHLHSAPCMLAAAEGTQFSDAGEEDEEEEGEKLSYLNSLAAAEGHGVSGLCPQSYVHTVLRDSCSGPKEQEEEVVSERSQKSCQLKKSLEAAGDCKASEDGERPKPRSRRKPRVLFSQAQVFELERRFKQQRYLSAPEREHLASSLKLTSTQVKIWFQNRRYKCKRQRQDKSLELGTHAPPPPPRRVAVPVLVRDGKPCVTPSAQAYGSPYGVGAGAYSYNSFPAYGYGNSAAAAAAAAAAAAAAAAYSGSYGCAYPTGGGGGGGGAASAATTAMQPACSATGGGSFVNVGNLGGFGSGGGAQPLHQGAAAGAACAQGTLQGIRAW"

     misc_feature    437..607
                     /gene="Nkx2-3"
                     /note="Region: Homeodomain; pfam00046"
                     /db_xref="CDD:459649"
     exon            351..1472
                     /gene="Nkx2-3"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

gatgatgataccaagcccggtcacctccacccctttctcagtcaaagacattttgaatctggaacagcagcggcacttccacggagcacacttgcaggcggaattggagcagcacttacactcggcgccctgcatgctggcagctgctgaagggacgcagttttctgatgcaggggaggaggacgaggaagaagagggagagaaattgtcctatttgaactcactagcggccgccgagggccacggagtttcgggtctctgtcctcagagctatgtccatacagtccttcgagactcttgcagcgggcccaaggagcaagaagaggaggttgtgagcgaacggagccaaaaaagctgccagttgaagaagtctctcgaagcggcgggagactgtaaagcgagcgaggacggcgagaggccgaagcctcgcagccgccggaagccccgggtgctcttctcgcaagctcaggtctttgagctggagcgcaggttcaagcagcagcggtacctgtcggcgcccgagcgcgagcatcttgccagcagcctgaagctcacgtccacacaggtgaagatctggttccagaatcgcaggtacaagtgcaagagacagcgacaggacaagtccctggagctggggacccacgcgccgccgccgccgccccgccgcgtggcagtgccggtgctcgtgcgggacggcaaaccgtgcgtcactcccagcgcgcaagcctacggctcgccctacggcgtgggtgccggcgcctactcctacaacagcttccccgcctacggctacgggaactcggcggccgcagccgctgcagcagcagcagccgcagccgcagccgcggcttacagcggcagctacggctgcgcctacccgacaggcggcggcggcggtggtggcggcgcagcctccgccgcgaccaccgcaatgcaacccgcctgcagcgccaccggcggcggatcttttgtgaacgtgggcaacctgggaggcttcggcagcggcggcggcgcgcaacccttgcatcaaggtgccgcagctggagccgcgtgcgcgcaggggaccttgcagggcatcagggcttggtaaggtctgggcaggacacgcggctggcgtcctaccgcaagctgggcgccgcgggaacgagacacgagaaaggacagacccaagggccatgtcccctcgttaaaataaaatacagacgtatcgctccttccaaggggccagggtcgcagcacactccaggcctgggaaagggctcagcggagaaaagatgccctggtccagtcgtcgtcaagactgtttgagacagaaacaccggccgggcgccagggagcaggtggcctccccaccctggctctgtggggagtgcgggaggctgtcgcttgctctccggaggaggagggggtgcttttctcttgccttcccttggccttctcgtagtgtggtcagggaaccggaccgaacaggg

//