2024-04-28 20:10:45, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_001107042 1863 bp mRNA linear ROD 17-DEC-2023 DEFINITION Rattus norvegicus homeo box B3 (Hoxb3), mRNA. ACCESSION NM_001107042 XM_001081342 XM_220893 VERSION NM_001107042.1 KEYWORDS RefSeq; RefSeq Select. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 1863) AUTHORS Jia X, Yang S, Wang X, Ruan J and Huang W. TITLE HOXB3 promotes trophoblast cell proliferation, invasion, and migration to alleviate preeclampsia via mediating the Notch/Wnt/beta-catenin pathway JOURNAL Eur J Pharmacol 960, 176015 (2023) PUBMED 37652291 REMARK GeneRIF: HOXB3 promotes trophoblast cell proliferation, invasion, and migration to alleviate preeclampsia via mediating the Notch/Wnt/beta-catenin pathway. REFERENCE 2 (bases 1 to 1863) AUTHORS Nagamachi A, Matsui H, Asou H, Ozaki Y, Aki D, Kanai A, Takubo K, Suda T, Nakamura T, Wolff L, Honda H and Inaba T. TITLE Haploinsufficiency of SAMD9L, an endosome fusion facilitator, causes myeloid malignancies in mice mimicking human diseases with monosomy 7 JOURNAL Cancer Cell 24 (3), 305-317 (2013) PUBMED 24029230 REFERENCE 3 (bases 1 to 1863) AUTHORS Wong EY, Wang XA, Mak SS, Sae-Pang JJ, Ling KW, Fritzsch B and Sham MH. TITLE Hoxb3 negatively regulates Hoxb1 expression in mouse hindbrain patterning JOURNAL Dev Biol 352 (2), 382-392 (2011) PUBMED 21320481 REFERENCE 4 (bases 1 to 1863) AUTHORS Chung N, Jee BK, Chae SW, Jeon YW, Lee KH and Rha HK. TITLE HOX gene analysis of endothelial cell differentiation in human bone marrow-derived mesenchymal stem cells JOURNAL Mol Biol Rep 36 (2), 227-235 (2009) PUBMED 17972163 REFERENCE 5 (bases 1 to 1863) AUTHORS Magnusson M, Brun AC, Lawrence HJ and Karlsson S. TITLE Hoxa9/hoxb3/hoxb4 compound null mice display severe hematopoietic defects JOURNAL Exp Hematol 35 (9), 1421-1428 (2007) PUBMED 17761289 REFERENCE 6 (bases 1 to 1863) AUTHORS Medina-Martinez O, Bradley A and Ramirez-Solis R. TITLE A large targeted deletion of Hoxb1-Hoxb9 produces a series of single-segment anterior homeotic transformations JOURNAL Dev Biol 222 (1), 71-83 (2000) PUBMED 10885747 REFERENCE 7 (bases 1 to 1863) AUTHORS Guazzi S, Pintonello ML, Vigano A and Boncinelli E. TITLE Regulatory interactions between the human HOXB1, HOXB2, and HOXB3 proteins and the upstream sequence of the Otx2 gene in embryonal carcinoma cells JOURNAL J Biol Chem 273 (18), 11092-11099 (1998) PUBMED 9556594 REFERENCE 8 (bases 1 to 1863) AUTHORS Manley NR and Capecchi MR. TITLE Hox group 3 paralogs regulate the development and migration of the thymus, thyroid, and parathyroid glands JOURNAL Dev Biol 195 (1), 1-15 (1998) PUBMED 9520319 REFERENCE 9 (bases 1 to 1863) AUTHORS Manley NR and Capecchi MR. TITLE Hox group 3 paralogous genes act synergistically in the formation of somitic and neural crest-derived structures JOURNAL Dev Biol 192 (2), 274-288 (1997) PUBMED 9441667 REFERENCE 10 (bases 1 to 1863) AUTHORS Guazzi S, Lonigro R, Pintonello L, Boncinelli E, Di Lauro R and Mavilio F. TITLE The thyroid transcription factor-1 gene is a candidate target for regulation by Hox proteins JOURNAL EMBO J 13 (14), 3339-3347 (1994) PUBMED 7913891 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from CH473948.1. On or before Oct 4, 2007 this sequence version replaced XM_001081342.1, XM_220893.4. ##RefSeq-Attributes-START## RefSeq Select criteria :: based on conservation, longest protein ##RefSeq-Attributes-END## FEATURES Location/Qualifiers source 1..1863 /organism="Rattus norvegicus" /mol_type="mRNA" /db_xref="taxon:10116" /chromosome="10" /map="10q26" gene 1..1863 /gene="Hoxb3" /note="homeo box B3" /db_xref="GeneID:303488" /db_xref="RGD:1310780" exon 1..913 /gene="Hoxb3" /inference="alignment:Splign:2.1.0" misc_feature 412..414 /gene="Hoxb3" /note="upstream in-frame stop codon" CDS 466..1755 /gene="Hoxb3" /codon_start=1 /product="homeobox protein Hox-B3" /protein_id="NP_001100512.1" /db_xref="GeneID:303488" /db_xref="RGD:1310780" /translation="
MQKATYYDNTAAALFGGYSSYPGSNGFGYDGPPQPPFQAATHLEGDYQRSACSLQSLGNAAPHAKSKELNGSCMRPGLAPEPLPAPPGSPPPSAAPTSTTSNSNNGGGPSKSGPPKCGASSNSTLTKQIFPWMKESRQTSKLKNSSPGTAEGCGGGGGGGGGGGSSSGGGGSGGGGGDKSPPGSAASKRARTAYTSAQLVELEKEFHFNRYLCRPRRVEMANLLNLSERQIKIWFQNRRMKYKKDQKAKGLASSSGGPSPAGSPPQPMQSTAGFMNALHSMTPSYDSPSPPAFSKGHQNAYALPSNYQPPLKGCGAPQKYPPTPAPEYESHVLQANGGAYGTPTMQGSPVYVGGGGYADPLPPPAGPSLYGLNHLSHHPSGNLDYNGAAPMAPGQHHGPCDPHPTYTDLSSHHAPPQGRIQEAPKLTHL"
misc_feature order(1027..1041,1045..1047,1096..1098,1114..1116, 1153..1155,1159..1164,1171..1176,1180..1188,1192..1197) /gene="Hoxb3" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238039" misc_feature order(1033..1035,1042..1044,1162..1164,1171..1176, 1183..1185) /gene="Hoxb3" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" misc_feature 1036..1194 /gene="Hoxb3" /note="Homeobox domain; Region: Homeobox; pfam00046" /db_xref="CDD:425441" misc_feature 1558..1746 /gene="Hoxb3" /note="Domain of unknown function (DUF4074); Region: DUF4074; pfam13293" /db_xref="CDD:433094" exon 914..1863 /gene="Hoxb3" /inference="alignment:Splign:2.1.0" ORIGIN
tagtgcaggcgccagagagaggcggtggtccacgaggcagtggtattttattcctaagtattcaccaaaggagtacagtcttgattttgtagaaaatggaaatggaaatcggtgttttctttttccctttaaaattaaagttgaagcgagaagcatccatgtcaggttagatacttggtctcagcgcctgctgcagagatagtggcgaggggagaagaaaaagaaaacctattgatgtcagttccctttttagttcctaagatggattcgaggcccagtcctcttctccccctctgtctcttctctcgccccgcaggtcagccgcttggaacagacccgggaggaggggggcagaaaggggaggggggtccggcgtgtcacgtgacccccaggggtgccaatgtccggtcgtgagggtatcaggcccttgcaagttgccacccactgcccgggcctcgcccagcgatgcagaaagccacctactacgacaacaccgcagctgcgctcttcggaggctactcctcgtaccctggcagcaatggtttcggctacgacgggcctccccagcccccctttcaggccgctacacacctggagggtgactaccagcgctcagcgtgttccctgcagtccctgggcaatgccgccccacatgccaagagcaaggagctcaacggcagctgcatgaggccaggcctggccccagagcccctgcccgcaccgccgggttcacccccacccagcgccgcacctaccagtaccactagcaacagcaataacgggggtgggcccagcaaaagcggcccccccaagtgcggtgccagctccaactccaccctcaccaaacagatattcccctggatgaaagagtcaaggcaaacgtccaagctgaaaaacagctccccgggcacagcagaaggttgtggtggcggcggcggcggcggtggcggcggcggtagtagcagcggcgggggcggcagcggcggcgggggaggggacaagagccccccggggtcggcggcgtccaagcgggcgcggacggcatacacaagcgcgcagctggttgagctggagaaggagttccacttcaaccgttatttgtgccggccgcgccgcgtcgagatggccaatctgctgaacctcagcgagcggcagatcaagatctggttccagaaccgccgcatgaagtacaagaaagaccagaaggccaaggggctggcctcgtcctccgggggtccctctccggccggaagccccccgcagcccatgcagtccacggccggcttcatgaacgccttacactccatgacccccagctacgacagcccgtccccaccagccttcagcaaaggccaccagaatgcctacgcgctgccttccaactatcagccccctctcaagggttgcggcgccccacagaagtaccccccgaccccggcgccggagtatgagtcccacgtcctccaagccaacgggggagcctacgggacgcccaccatgcagggcagtcctgtctatgtgggcgggggtggctacgcggatccgttgccgccccctgccggcccctccctctacggcctcaatcacctttcccaccacccctcggggaacctggactacaacggggcggcccctatggcccccggccagcatcacggaccctgtgaccctcaccccacgtacacagacctctcctctcaccacgcaccgcctcagggtagaatccaagaagcgcccaaactgacacacctgtgatgggaggggcgggctggggaggggggggtgaggttaagggacagggagaccgtggaactgggggatgggcgcggtttggagtcctgaaaaaggtatgtgttggggttg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]