2024-04-28 09:19:11, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_001100639 2566 bp mRNA linear ROD 08-NOV-2023 DEFINITION Rattus norvegicus POU class 2 homeobox 1 (Pou2f1), mRNA. ACCESSION NM_001100639 XM_001075635 XM_341148 VERSION NM_001100639.1 KEYWORDS RefSeq; RefSeq Select. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 2566) AUTHORS Gu YH, Wang J, Lu WC, Cheng Y, Tao R, Zhang SJ, Xu T, Zhai KW, Luo SX and Xin WJ. TITLE POU2F1/DNMT3a Pathway Participates in Neuropathic Pain by Hypermethylation-Mediated LRFN4 Downregulation Following Oxaliplatin Treatment JOURNAL Neurochem Res 48 (12), 3652-3664 (2023) PUBMED 37592110 REMARK GeneRIF: POU2F1/DNMT3a Pathway Participates in Neuropathic Pain by Hypermethylation-Mediated LRFN4 Downregulation Following Oxaliplatin Treatment. REFERENCE 2 (bases 1 to 2566) AUTHORS Zhang WF, Zhu TT, Xiong YW, Xiong AZ, Ge XY, Hu CP and Zhang Z. TITLE Negative feedback regulation between microRNA let-7g and LOX-1 mediated hypoxia-induced PASMCs proliferation JOURNAL Biochem Biophys Res Commun 488 (4), 655-663 (2017) PUBMED 28108289 REMARK Erratum:[Biochem Biophys Res Commun. 2017 Oct 21;492(3):529. PMID: 28851539] REFERENCE 3 (bases 1 to 2566) AUTHORS Gahete MD, Duran-Prado M, Delgado-Niebla E, Garrido JJ, Rhodes SJ, Garcia-Navarro S, Gracia-Navarro F, Malagon MM, Luque RM and Castano JP. TITLE Porcine sst1 can physically interact with other somatostatin receptors, and its expression is regulated by metabolic/inflammatory sensors JOURNAL Am J Physiol Endocrinol Metab 306 (5), E483-E493 (2014) PUBMED 24368669 REFERENCE 4 (bases 1 to 2566) AUTHORS Dumay-Odelot H, Durrieu-Gaillard S, Da Silva D, Roeder RG and Teichmann M. TITLE Cell growth- and differentiation-dependent regulation of RNA polymerase III transcription JOURNAL Cell Cycle 9 (18), 3687-3699 (2010) PUBMED 20890107 REMARK Review article REFERENCE 5 (bases 1 to 2566) AUTHORS Wang P, Wang Q, Sun J, Wu J, Li H, Zhang N, Huang Y, Su B, Li RK, Liu L, Zhang Y, Elsholtz HP, Hu J, Gaisano HY and Jin T. TITLE POU homeodomain protein Oct-1 functions as a sensor for cyclic AMP JOURNAL J Biol Chem 284 (39), 26456-26465 (2009) PUBMED 19617623 REMARK GeneRIF: Data show that cAMP elevation reduces nuclear Oct-1 content in primary pancreatic islet cells. REFERENCE 6 (bases 1 to 2566) AUTHORS Dailey L, Yuan H and Basilico C. TITLE Interaction between a novel F9-specific factor and octamer-binding proteins is required for cell-type-restricted activity of the fibroblast growth factor 4 enhancer JOURNAL Mol Cell Biol 14 (12), 7758-7769 (1994) PUBMED 7969117 REFERENCE 7 (bases 1 to 2566) AUTHORS Rosfjord E and Rizzino A. TITLE The octamer motif present in the Rex-1 promoter binds Oct-1 and Oct-3 expressed by EC cells and ES cells JOURNAL Biochem Biophys Res Commun 203 (3), 1795-1802 (1994) PUBMED 7945330 REFERENCE 8 (bases 1 to 2566) AUTHORS Lillycrop KA and Latchman DS. TITLE Cloning and sequencing of the rat Oct-1 POU box JOURNAL Nucleic Acids Res 19 (13), 3744 (1991) PUBMED 1677182 REFERENCE 9 (bases 1 to 2566) AUTHORS Timchenko NA, Zhuchenko OP, Timchenko LT, Iguchi-Ariga SM, Ariga H, Bozhkov VM and Tomilin NV. TITLE Rat DNA sequence associated with a complex form of DNA polymerase alpha in nonregenerating liver interacts with a ubiquitous transcription/replication factor Oct-1 JOURNAL Biomed Sci 2 (6), 595-600 (1991) PUBMED 1841628 REFERENCE 10 (bases 1 to 2566) AUTHORS Scholer HR, Ruppert S, Suzuki N, Chowdhury K and Gruss P. TITLE New type of POU domain in germ line-specific protein Oct-4 JOURNAL Nature 344 (6265), 435-439 (1990) PUBMED 1690859 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from DV214198.1 and U17013.1. On or before Dec 17, 2009 this sequence version replaced XM_341148.3, XM_001075635.1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## RNAseq introns :: mixed/partial sample support SAMD00132261, SAMD00132262 [ECO:0000350] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on conservation, expression, longest protein ##RefSeq-Attributes-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-410 DV214198.1 1-410 411-2566 U17013.1 1-2156 FEATURES Location/Qualifiers source 1..2566 /organism="Rattus norvegicus" /mol_type="mRNA" /db_xref="taxon:10116" /chromosome="13" /map="13q23" gene 1..2566 /gene="Pou2f1" /note="POU class 2 homeobox 1" /db_xref="GeneID:171068" /db_xref="RGD:621689" exon 1..63 /gene="Pou2f1" /inference="alignment:Splign:2.1.0" CDS 3..2309 /gene="Pou2f1" /note="NF-A1; OTF-1; oct-1; octamer-binding transcription factor 1; octamer-binding protein 1" /codon_start=1 /product="POU domain, class 2, transcription factor 1" /protein_id="NP_001094109.1" /db_xref="GeneID:171068" /db_xref="RGD:621689" /translation="
MADGGAASQDESSAAAAAAADSRMNNPSETNKSSMESGDASTGTQTNGLDFEKQPVPVGGAISTAQAQAFLGHLHQVQLAGTSLQAAAQSLNVQSKSSEESGDSQQSSQPSQQPSVQSAIPQTQLMLAGGQITGLTLTPAQQQLLLQQAQAQAQLLAAAVQQHSASQQHSAAGATISASAATPMTQIPLSQPIQIAQDLQQLQQLQQQNLNLQQFVLVHPTTNLQPAQFIISQTPQGQQGLLQAQNLLTQLPQQSQANLLQPQPSITLTSQPTTPTRTIAATPIQTLPQSQTTPKRIDTPSLEEPSDLEELEQFAKTFKQRRIKLGFTQGDVGLAMGKLYGNDFSQTTISRFEALNLSFKNMCKLKPLLEKWLNDAENLSSDSTASSPSALNSPGLGAEGLNRRRKKRTSIETNIRVALEKSFMENQKPTSEDITLIAEQLNMEKEVIRVWFCNRRQKEKRINPPSSGGTSSSPIKAIFPSPTSLVATTPSLVTSSTATTLTVNPVLPLTSAAMTNLSLTGTTDSTSNNTATVISTAPPASSAVTSPSLSPSPSASASTSEASSASETSTTQTTSTPLPSPLGASQVMVTASGLQTAAAAALQGAAQLPANASLAAMAAAAGLNPGLMAPSQFAAGGALLSLNPGTLGGALSPALMSNSTLATIQALASSGSLPITSLDATGNLVFANAGGAPNIVTAPLFLNPQNLSLLTSNPVSLVSAAAASTGNSAPTASLHASSTSTESIQNSLFTVASASGAASTTTAASKAQ"
misc_feature 909..1133 /gene="Pou2f1" /note="Found in Pit-Oct-Unc transcription factors; Region: POU; smart00352" /db_xref="CDD:197673" misc_feature order(1215..1229,1233..1235,1284..1286,1302..1304, 1341..1343,1347..1352,1359..1364,1368..1376,1380..1385) /gene="Pou2f1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238039" misc_feature 1221..1382 /gene="Pou2f1" /note="Homeobox domain; Region: Homeobox; pfam00046" /db_xref="CDD:425441" misc_feature order(1221..1223,1230..1232,1350..1352,1359..1364, 1371..1373) /gene="Pou2f1" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" misc_feature 1425..2264 /gene="Pou2f1" /note="POU domain, class 2, transcription factor 1 C-terminal; Region: POU2F1_C; pfam19536" /db_xref="CDD:437368" exon 64..129 /gene="Pou2f1" /inference="alignment:Splign:2.1.0" exon 130..230 /gene="Pou2f1" /inference="alignment:Splign:2.1.0" exon 231..284 /gene="Pou2f1" /inference="alignment:Splign:2.1.0" exon 285..404 /gene="Pou2f1" /inference="alignment:Splign:2.1.0" exon 405..593 /gene="Pou2f1" /inference="alignment:Splign:2.1.0" exon 594..720 /gene="Pou2f1" /inference="alignment:Splign:2.1.0" exon 721..815 /gene="Pou2f1" /inference="alignment:Splign:2.1.0" exon 816..989 /gene="Pou2f1" /inference="alignment:Splign:2.1.0" exon 990..1131 /gene="Pou2f1" /inference="alignment:Splign:2.1.0" exon 1132..1277 /gene="Pou2f1" /inference="alignment:Splign:2.1.0" exon 1278..1457 /gene="Pou2f1" /inference="alignment:Splign:2.1.0" exon 1458..1563 /gene="Pou2f1" /inference="alignment:Splign:2.1.0" exon 1564..1909 /gene="Pou2f1" /inference="alignment:Splign:2.1.0" exon 1910..1998 /gene="Pou2f1" /inference="alignment:Splign:2.1.0" exon 1999..2566 /gene="Pou2f1" /inference="alignment:Splign:2.1.0" ORIGIN
aaatggcggacggaggagcagcgagtcaagatgagagttcagccgcggcggcagcagcagcagactcaagaatgaacaatccgtcagaaaccaataagtcatctatggagagtggagatgccagcacaggcacacagaccaatggcctggactttgagaagcagcccgtgcctgtcggaggggccatctccacagcccaggcccaggctttccttgggcatcttcaccaggtccagctcgctgggacaagtttacaggctgctgctcaatctttaaatgtacagtctaaatctagtgaagagtccggagattcgcagcagtcaagccagccttcccagcagccttcagtgcagtcagccattccccagactcagctaatgctggccgggggacagataactgggctcacactgacaccagcccagcaacagcttttactacagcaggcccaggcccaggcccagctcctggctgctgcagtgcagcaacactccgccagccaacagcacagtgctgctggggccaccatctcagcctccgctgccacacccatgacgcagatccccctgtctcagcccatacagattgcacaggatcttcaacaattgcaacagcttcagcagcaaaatctcaacttgcaacagttcgtcttggtgcacccaaccaccaacttgcaaccagcacagtttatcatctctcagaccccccagggccagcagggtctcctgcaagcgcaaaatcttttaacgcaactacctcagcaaagccaagccaacctcctacagccacagccaagcatcaccctcacgtcccagcctaccaccccaactcgcacaatagcagcaaccccaattcagacacttccacagagccagacaacaccaaagcgaattgatactcccagcttggaggagcccagtgaccttgaggagcttgagcaatttgccaagacttttaaacaaagacgaatcaaacttggattcactcagggtgatgttgggcttgctatggggaaattatatggaaatgacttcagccaaaccaccatctctcgctttgaagccttgaacctcagctttaagaacatgtgcaagttaaagccccttttagagaagtggctaaatgacgcggagaacctctcatctgattctacagcatctagcccaagtgctttgaattctccagggttgggggctgagggcttgaatcgtaggaggaaaaaacgcaccagcatagagaccaacatccgtgtggccttagaaaagagtttcatggagaatcaaaagcctacctcggaagatatcaccttgattgctgaacagctcaatatggagaaggaggtgattcgtgtttggttttgtaaccgccgccagaaggagaaaagaatcaacccgccaagcagtggtgggaccagcagctcaccaatcaaagcaattttccccagcccaacctcactggtggcaaccactccaagccttgtgacaagcagtacagcaactaccctcacagtcaaccctgtgctccccttaaccagtgctgccatgactaatctttctcttacaggcactacagactccacgtccaacaacacggccaccgtgatttccacagcaccccctgcttcctcagcagtcacatctccctccttgagtccctctccttctgcctcagcctccacctctgaggcctctagtgccagcgagaccagcacaacacagaccacctccacacctctcccctcccctcttggagccagccaggtgatggtgacagcctctggcttacagactgcagccgccgctgctctccaaggagctgcacagttgccagcaaatgccagtcttgctgctatggctgctgctgcaggactcaatccaggcctgatggcaccctcacagtttgctgctggaggtgccttactcagtctcaatccggggaccctgggtggggctctcagcccggccctgatgagcaacagtacactggcaaccattcaagctcttgcttctagtggctctcttccaataacatctctggatgcaactgggaacctggtattcgccaatgcaggaggagcccccaacatcgtgactgcccctctgttcctgaaccctcagaacctctctctgctcaccagcaacccagtaagcttggtttctgccgctgcagcctccacagggaactccgcacctacagccagccttcatgcctcctccacctcaactgagtccatccagaactctctgttcacagtggcctctgccagcggggctgcctccaccaccacagctgcctccaaggcacagtgagctggacgcagagctggggctttcctcactgcagggtgataggctggctatcagctggctaaaacatgacgcctgtcattggcttcctcccaccatgttgtgaggatgaggaagacatggagagaagaaaaaaattacacataacaacaaaaaaaaagaatggagacaggacaacgtttgcctaattttataataaaaacaatgtcttttcaggattgcttcatggattggagaactttctaaccaaaaattttaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]