LOCUS       NR_185067               1488 bp    RNA     linear   ROD 11-OCT-2023
DEFINITION  Mus musculus homeobox A9 (Hoxa9), transcript variant 8, non-coding
            RNA.
ACCESSION   NR_185067
VERSION     NR_185067.1
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 1488)
  AUTHORS   Fu X, Fu P, Yang T and Niu T.
  TITLE     Homeobox A9 is a novel mediator of vascular smooth muscle cell
            phenotypic switching and proliferation by regulating methyl-CpG
            binding protein 2
  JOURNAL   Cell Signal 108, 110695 (2023)
   PUBMED   37127144
  REMARK    GeneRIF: Homeobox A9 is a novel mediator of vascular smooth muscle
            cell phenotypic switching and proliferation by regulating
            methyl-CpG binding protein 2.
REFERENCE   2  (bases 1 to 1488)
  AUTHORS   Kumar S, Alam SS, Bareke E, Beauchamp MC, Dong Y, Chan W, Majewski
            J and Jerome-Majewska LA.
  TITLE     Sf3b4 regulates chromatin remodeler splicing and Hox expression
  JOURNAL   Differentiation 131, 59-73 (2023)
   PUBMED   37167859
REFERENCE   3  (bases 1 to 1488)
  AUTHORS   Lieske A, Agyeman-Duah E, Selich A, Dorpmund N, Talbot SR,
            Schambach A and Maetzig T.
  TITLE     A pro B cell population forms the apex of the leukemic hierarchy in
            Hoxa9/Meis1-dependent AML
  JOURNAL   Leukemia 37 (1), 79-90 (2023)
   PUBMED   36517672
  REMARK    GeneRIF: A pro B cell population forms the apex of the leukemic
            hierarchy in Hoxa9/Meis1-dependent AML.
REFERENCE   4  (bases 1 to 1488)
  AUTHORS   Popovic R, Erfurth F and Zeleznik-Le N.
  TITLE     Transcriptional complexity of the HOXA9 locus
  JOURNAL   Blood Cells Mol Dis 40 (2), 156-159 (2008)
   PUBMED   17916434
  REMARK    Review article
REFERENCE   5  (bases 1 to 1488)
  AUTHORS   Fujimoto S, Araki K, Chisaka O, Araki M, Takagi K and Yamamura K.
  TITLE     Analysis of the murine Hoxa-9 cDNA: an alternatively spliced
            transcript encodes a truncated protein lacking the homeodomain
  JOURNAL   Gene 209 (1-2), 77-85 (1998)
   PUBMED   9524228
REFERENCE   6  (bases 1 to 1488)
  AUTHORS   Lawrence HJ, Helgason CD, Sauvageau G, Fong S, Izon DJ, Humphries
            RK and Largman C.
  TITLE     Mice bearing a targeted interruption of the homeobox gene HOXA9
            have defects in myeloid, erythroid, and lymphoid hematopoiesis
  JOURNAL   Blood 89 (6), 1922-1930 (1997)
   PUBMED   9058712
REFERENCE   7  (bases 1 to 1488)
  AUTHORS   Rijli FM, Matyas R, Pellegrini M, Dierich A, Gruss P, Dolle P and
            Chambon P.
  TITLE     Cryptorchidism and homeotic transformations of spinal nerves and
            vertebrae in Hoxa-10 mutant mice
  JOURNAL   Proc Natl Acad Sci U S A 92 (18), 8185-8189 (1995)
   PUBMED   7667266
REFERENCE   8  (bases 1 to 1488)
  AUTHORS   Satokata I, Benson G and Maas R.
  TITLE     Sexually dimorphic sterility phenotypes in Hoxa10-deficient mice
  JOURNAL   Nature 374 (6521), 460-463 (1995)
   PUBMED   7700356
REFERENCE   9  (bases 1 to 1488)
  AUTHORS   Scott,M.P.
  TITLE     Vertebrate homeobox gene nomenclature
  JOURNAL   Cell 71 (4), 551-553 (1992)
   PUBMED   1358459
REFERENCE   10 (bases 1 to 1488)
  AUTHORS   Rubin MR, King W, Toth LE, Sawczuk IS, Levine MS, D'Eustachio P and
            Nguyen-Huu MC.
  TITLE     Murine Hox-1.7 homeo-box gene: cloning, chromosomal location, and
            expression
  JOURNAL   Mol Cell Biol 7 (10), 3836-3841 (1987)
   PUBMED   2891029
  REMARK    Erratum:[Mol Cell Biol 1988 Dec;8(12):5593]
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AC015583.34.
            
            Summary: This gene is located in a cluster of developmentally and
            temporally regulated genes on chromosome 6 encoding proteins
            involved in pattern formation. These proteins contain a
            characteristic DNA-binding motif called a homeodomain and function
            in transcriptional regulation. There are four distinct clusters of
            similar genes on chromosomes 2, 6, 11, and 15. The protein encoded
            by this gene is important for hematopoeisis. Alternative splicing
            results in multiple transcript variants. [provided by RefSeq, Mar
            2013].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR13422600.2025586.1,
                                           SRR13422598.1288903.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN01164133, SAMN01164137
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-102               AC015583.34        88120-88221
            103-1488            AC015583.34        88884-90269
FEATURES             Location/Qualifiers
     source          1..1488
                     /organism="Mus musculus"
                     /mol_type="transcribed RNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="6"
                     /map="6 25.4 cM"
     gene            1..1488
                     /gene="Hoxa9"
                     /gene_synonym="D6a9; Hox-1.7"
                     /note="homeobox A9"
                     /db_xref="GeneID:15405"
                     /db_xref="MGI:MGI:96180"
     misc_RNA        1..1488
                     /gene="Hoxa9"
                     /gene_synonym="D6a9; Hox-1.7"
                     /product="homeobox A9, transcript variant 8"
                     /db_xref="GeneID:15405"
                     /db_xref="MGI:MGI:96180"
     exon            1..102
                     /gene="Hoxa9"
                     /gene_synonym="D6a9; Hox-1.7"
                     /inference="alignment:Splign:2.1.0"
     exon            103..1488
                     /gene="Hoxa9"
                     /gene_synonym="D6a9; Hox-1.7"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    207..341
                     /gene="Hoxa9"
                     /gene_synonym="D6a9; Hox-1.7"
                     /inference="COORDINATES: ab initio prediction:ORF Finder"
                     /note="predicted ORF does not meet quality criteria for
                     protein coding locus with longer protein data"
                     /db_xref="GeneID:15405"
ORIGIN      

aagctgccctggcctaggacagacagactttgggcggttcttcgaaagcagcgcagagaagtcttttgtgcagctagattgttcacaaactgtggcagcaacataacccggctgccaactggctacatgctcgctccactcggaagaagcgatgcccctacacaaaacaccagacgctggaactggagaaggagtttctgtttaacatgtacctcacacgggaccgcaggtacgaggtggcccggctgctcaacctcaccgaaaggcaggtcaagatctggttccagaaccgcaggatgaaaatgaagaaaatcaacaaggaccgagcaaaagacgagtgagccttttaggggctcatttaaaaagagagcaagctagaaagaaaaagaaaggactgtccgtctccctctgtctcctctcccccaaacccagcctccacccgcacaaaggggctctaaatcccaggcctcatctccccactggcagtccgtgctcaggctggctcttaggcctgcggctttgatggaggaggtattgtaagctttccattttatagaaggcacacacacacacaagggagggcattagcgctattggctgtatgtgctagcttgtatatatatatatatatttaaaaaaaatctacctgcttctgactttaagcaaaaggaaagaaaactacctttttatataatgcacaactgttgatgactggctgtatagtttttagtctctgtagctaatttaatttgctcttcgtgtggcagatcattctgccaaaatacttgaacactgtgttttattgtggtaattatgttttgtgactcaaacttctgtgctgggtgaagtacccattgtgattgtggaagctagaattcaatttgaactcaggttgtttatggggggagagaagctgtggcataatgtatagctctgtagtcttctgtgtagctagactgttaacctacgattgtaaactagctgtaaggatttcccagtgaaatcagatttggaaagaaaagagagatagttctccgggatgcatagattcatgatttatctacttttgaaatgtgggcttcttcatctttacgttctagactccaattttgtccaatgtatatagaatctccatattaaagaaatattcataatcagaaagcttgaatattgtttttgcaccagaggagaagtgaggaaattcggagctatacgtgtgtgcagagggttgctacctatgggtttacgcttaattttaattgggagaaagtgagtgcttattgtaatggagttaattttattgataataaattatacaccatgaaactgctcttgggctactgtagatttgtatccttggtgaatttggggttcccatcggattgaacatacactgtatattttgcaatagttacctcaaggcctactgaccaaattgttgtgtcgagatatttaacttttgccaaataaaatatattgattctttta

//