GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-08-21 19:05:43, GGRNA.v2 : RefSeq release 230 (May, 2025)

LOCUS       NR_038086               1117 bp    RNA     linear   ROD 17-SEP-2024
DEFINITION  Mus musculus SIX homeobox 3, opposite strand 1 (Six3os1),
            transcript variant 8, long non-coding RNA.
ACCESSION   NR_038086
VERSION     NR_038086.1
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 1117)
  AUTHORS   Song,X., Chen,H., Shang,Z., Du,H., Li,Z., Wen,Y., Liu,G., Qi,D.,
            You,Y., Yang,Z., Zhang,Z. and Xu,Z.
  TITLE     Homeobox Gene Six3 is Required for the Differentiation of D2-Type
            Medium Spiny Neurons
  JOURNAL   Neurosci Bull 37 (7), 985-998 (2021)
   PUBMED   34014554
REFERENCE   2  (bases 1 to 1117)
  AUTHORS   Quintana-Urzainqui,I., Kozic,Z., Mitra,S., Tian,T., Manuel,M.,
            Mason,J.O. and Price,D.J.
  TITLE     Tissue-Specific Actions of Pax6 on Proliferation and
            Differentiation Balance in Developing Forebrain Are Foxg1 Dependent
  JOURNAL   iScience 10, 171-191 (2018)
   PUBMED   30529950
REFERENCE   3  (bases 1 to 1117)
  AUTHORS   Percival,C.J., Green,R., Roseman,C.C., Gatti,D.M., Morgan,J.L.,
            Murray,S.A., Donahue,L.R., Mayeux,J.M., Pollard,K.M., Hua,K.,
            Pomp,D., Marcucio,R. and Hallgrimsson,B.
  TITLE     Developmental constraint through negative pleiotropy in the
            zygomatic arch
  JOURNAL   Evodevo 9, 3 (2018)
   PUBMED   29423138
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 1117)
  AUTHORS   Rapicavoli,N.A., Poth,E.M., Zhu,H. and Blackshaw,S.
  TITLE     The long noncoding RNA Six3OS acts in trans to regulate retinal
            development by modulating Six3 activity
  JOURNAL   Neural Dev 6, 32 (2011)
   PUBMED   21936910
  REMARK    GeneRIF: Six3OS regulates Six3 activity in developing retina by a
            mechanism via which promoter-associated long non-coding RNAs can
            modulate the activity of their associated protein coding genes
            during development.
            Publication Status: Online-Only
REFERENCE   5  (bases 1 to 1117)
  AUTHORS   Geng,X., Lavado,A., Lagutin,O.V., Liu,W. and Oliver,G.
  TITLE     Expression of Six3 Opposite Strand (Six3OS) during mouse embryonic
            development
  JOURNAL   Gene Expr Patterns 7 (3), 252-257 (2007)
   PUBMED   17084678
REFERENCE   6  (bases 1 to 1117)
  AUTHORS   Alfano,G., Vitiello,C., Caccioppoli,C., Caramico,T., Carola,A.,
            Szego,M.J., McInnes,R.R., Auricchio,A. and Banfi,S.
  TITLE     Natural antisense transcripts associated with genes involved in eye
            development
  JOURNAL   Hum Mol Genet 14 (7), 913-923 (2005)
   PUBMED   15703187
REFERENCE   7  (bases 1 to 1117)
  AUTHORS   Blackshaw,S., Harpavat,S., Trimarchi,J., Cai,L., Huang,H.,
            Kuo,W.P., Weber,G., Lee,K., Fraioli,R.E., Cho,S.H., Yung,R.,
            Asch,E., Ohno-Machado,L., Wong,W.H. and Cepko,C.L.
  TITLE     Genomic analysis of mouse retinal development
  JOURNAL   PLoS Biol 2 (9), E247 (2004)
   PUBMED   15226823
REFERENCE   8  (bases 1 to 1117)
  AUTHORS   Mu,X., Zhao,S., Pershad,R., Hsieh,T.F., Scarpa,A., Wang,S.W.,
            White,R.A., Beremand,P.D., Thomas,T.L., Gan,L. and Klein,W.H.
  TITLE     Gene expression in the developing mouse retina by EST sequencing
            and microarray analysis
  JOURNAL   Nucleic Acids Res 29 (24), 4983-4993 (2001)
   PUBMED   11812828
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AK053722.1, CA527570.1 and AC166821.2.
            
            Transcript Variant: This variant (8) lacks an internal segment,
            compared to variant 1.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: CA527570.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN01164138, SAMN01164139
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-56                AK053722.1         3-58
            57-656              CA527570.1         1-600
            657-1117            AC166821.2         67003-67463         c
FEATURES             Location/Qualifiers
     source          1..1117
                     /organism="Mus musculus"
                     /mol_type="transcribed RNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="17"
                     /map="17 55.42 cM"
     gene            1..1117
                     /gene="Six3os1"
                     /gene_synonym="D17Mgi26; E130112H22Rik; Rncr1; Six3os"
                     /note="SIX homeobox 3, opposite strand 1"
                     /db_xref="GeneID:100043902"
                     /db_xref="MGI:MGI:1925118"
     ncRNA           1..1117
                     /ncRNA_class="lncRNA"
                     /gene="Six3os1"
                     /gene_synonym="D17Mgi26; E130112H22Rik; Rncr1; Six3os"
                     /product="SIX homeobox 3, opposite strand 1, transcript
                     variant 8"
                     /db_xref="GeneID:100043902"
                     /db_xref="MGI:MGI:1925118"
     exon            1..340
                     /gene="Six3os1"
                     /gene_synonym="D17Mgi26; E130112H22Rik; Rncr1; Six3os"
                     /inference="alignment:Splign:2.1.0"
     exon            341..490
                     /gene="Six3os1"
                     /gene_synonym="D17Mgi26; E130112H22Rik; Rncr1; Six3os"
                     /inference="alignment:Splign:2.1.0"
     exon            491..535
                     /gene="Six3os1"
                     /gene_synonym="D17Mgi26; E130112H22Rik; Rncr1; Six3os"
                     /inference="alignment:Splign:2.1.0"
     exon            536..1117
                     /gene="Six3os1"
                     /gene_synonym="D17Mgi26; E130112H22Rik; Rncr1; Six3os"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
aaaaccctcgccactcatgaagaactgaggcaaaaggatcacagatgctgctcggggccagccctatactccctccagtgcctggtctccggtggacccgcggggctctgcagttctctggcggccgcgccttgtaagcgctaagccgggaggagggcgcaggcagggcgcacagctctgagcgcgaccctacccggctcgggcccgcagcaaccccgactgtccgagagcctctccccaagcaaggctctgcgccgccctctgagcccacctcctggccacaacgctgcctgcgcttctccagcccaggccggaagccctatgctgcctcccgaagccggactttctggaagcccatcttcgtatgctcaccagcccaccctcctacgctggtcagagtgagattgctaacctcaagaccccattcaatgccagctttcaactactgctgaagaccaatgtaggtcctggaatagaagaactgcagagtatccggagctggccgaccccagactgattctcaacaggtggctggcgtcaatgctctagagatgggacctcgccttccaaggtgtcttcactatcacagggcccgggctctctgcctcagcccaaccctgggcttgcgctcagagaggaggtattccgacggaaaaaaatcccatacatttttaactacagtgattactaaattaatagcaggcaccaagacagatgtcaaaacgtcttgaaaatgtttatctgtgaataattgagaaggtagtgggacgcattatctgattgtgtaatgaaatatgtatgaggaacagctgtttgcagcagccccttccccttgccgccttagccagggcccttctctcgcaagctttcttctactttcttccacctttttcttccttctactttctagttcgctctcttcttccttaactgctcgcacggctttggctgcagtgaacccagagtcgcctggttctctgatgaaggttagccacaaggtttcctctaagccttgctggattggcgttccgtagtgggatgaggcttcgttgtctgctgttctggccatcgcgccttccggccaggctgcccgctgggtctccatggagtctgcggg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]