2025-04-05 12:46:02, GGRNA.v2 : RefSeq release 228 (Jan, 2025)
LOCUS NR_029821 89 bp RNA linear ROD 01-OCT-2024 DEFINITION Mus musculus microRNA 181c (Mir181c), microRNA. ACCESSION NR_029821 VERSION NR_029821.1 KEYWORDS RefSeq. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 89) AUTHORS Quiroga,D., Roman,B., Salih,M., Daccarett-Bojanini,W.N., Garbus,H., Ebenebe,O.V., Dodd-O,J.M., O'Rourke,B., Kohr,M. and Das,S. TITLE Sex-dependent phosphorylation of Argonaute 2 reduces the mitochondrial translocation of miR-181c and induces cardioprotection in females JOURNAL J Mol Cell Cardiol 194, 59-69 (2024) PUBMED 38880194 REMARK GeneRIF: Sex-dependent phosphorylation of Argonaute 2 reduces the mitochondrial translocation of miR-181c and induces cardioprotection in females. REFERENCE 2 (bases 1 to 89) AUTHORS Li,R., Yao,S., Wei,F., Chen,M., Zhong,Y., Zou,C., Chen,L., Wei,L., Yang,C., Zhang,X. and Liu,Y. TITLE Downregulation of miR-181c-5p in Alzheimer's disease weakens the response of microglia to Abeta phagocytosis JOURNAL Sci Rep 14 (1), 11487 (2024) PUBMED 38769091 REMARK GeneRIF: Downregulation of miR-181c-5p in Alzheimer's disease weakens the response of microglia to Abeta phagocytosis. Publication Status: Online-Only REFERENCE 3 (bases 1 to 89) AUTHORS Hu,Y., Hu,C., Yin,J., Zhong,J., Deng,Y. and Yang,G. TITLE MiR-181c-5p ameliorates learning and memory in sleep-deprived mice via HMGB1/TLR4/NF-kappaB pathway JOURNAL An Acad Bras Cienc 95 (suppl 1), e20220750 (2023) PUBMED 37466537 REMARK GeneRIF: MiR-181c-5p ameliorates learning and memory in sleep-deprived mice via HMGB1/TLR4/NF-kappaB pathway. Publication Status: Online-Only REFERENCE 4 (bases 1 to 89) AUTHORS Jimenez,M.T., Clark,M.L., Wright,J.M., Michieletto,M.F., Liu,S., Erickson,I., Dohnalova,L., Uhr,G.T., Tello-Cajiao,J., Joannas,L., Williams,A., Gagliani,N., Bewtra,M., Tomov,V.T., Thaiss,C.A. and Henao-Mejia,J. TITLE The miR-181 family regulates colonic inflammation through its activity in the intestinal epithelium JOURNAL J Exp Med 219 (12) (2022) PUBMED 36074090 REFERENCE 5 (bases 1 to 89) AUTHORS Dogan,A.E., Hamid,S.M., Yildirim,A.D., Yildirim,Z., Sen,G., Riera,C.E., Gottlieb,R.A. and Erbay,E. TITLE PACT establishes a posttranscriptional brake on mitochondrial biogenesis by promoting the maturation of miR-181c JOURNAL J Biol Chem 298 (7), 102050 (2022) PUBMED 35598827 REMARK GeneRIF: PACT establishes a posttranscriptional brake on mitochondrial biogenesis by promoting the maturation of miR-181c. REFERENCE 6 (bases 1 to 89) AUTHORS Xu,S., Witmer,P.D., Lumayag,S., Kovacs,B. and Valle,D. TITLE MicroRNA (miRNA) transcriptome of mouse retina and identification of a sensory organ-specific miRNA cluster JOURNAL J Biol Chem 282 (34), 25053-25066 (2007) PUBMED 17597072 REFERENCE 7 (bases 1 to 89) AUTHORS Tang,F., Kaneda,M., O'Carroll,D., Hajkova,P., Barton,S.C., Sun,Y.A., Lee,C., Tarakhovsky,A., Lao,K. and Surani,M.A. TITLE Maternal microRNAs are essential for mouse zygotic development JOURNAL Genes Dev 21 (6), 644-648 (2007) PUBMED 17369397 REFERENCE 8 (bases 1 to 89) AUTHORS Watanabe,T., Takeda,A., Tsukiyama,T., Mise,K., Okuno,T., Sasaki,H., Minami,N. and Imai,H. TITLE Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes JOURNAL Genes Dev 20 (13), 1732-1743 (2006) PUBMED 16766679 REFERENCE 9 (bases 1 to 89) AUTHORS Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and Enright,A.J. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006) PUBMED 16381832 REFERENCE 10 (bases 1 to 89) AUTHORS Lim,L.P., Glasner,M.E., Yekta,S., Burge,C.B. and Bartel,D.P. TITLE Vertebrate microRNA genes JOURNAL Science 299 (5612), 1540 (2003) PUBMED 12624257 COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from AC159266.3. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript is intronless :: LM608651.1 [ECO:0000345] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-89 AC159266.3 171122-171210 c FEATURES Location/Qualifiers source 1..89 /organism="Mus musculus" /mol_type="transcribed RNA" /strain="C57BL/6" /db_xref="taxon:10090" /chromosome="8" /map="8 40.47 cM" gene 1..89 /gene="Mir181c" /gene_synonym="mir-181c; Mirn181c" /note="microRNA 181c" /db_xref="GeneID:723819" /db_xref="MGI:MGI:3618737" /db_xref="miRBase:MI0000724" precursor_RNA 1..89 /gene="Mir181c" /gene_synonym="mir-181c; Mirn181c" /product="microRNA 181c" /db_xref="GeneID:723819" /db_xref="MGI:MGI:3618737" /db_xref="miRBase:MI0000724" exon 1..89 /gene="Mir181c" /gene_synonym="mir-181c; Mirn181c" /inference="alignment:Splign:2.1.0" ncRNA 17..38 /ncRNA_class="miRNA" /gene="Mir181c" /gene_synonym="mir-181c; Mirn181c" /product="mmu-miR-181c-5p" /db_xref="miRBase:MIMAT0000674" /db_xref="GeneID:723819" /db_xref="MGI:MGI:3618737" /db_xref="miRBase:MI0000724" ncRNA 56..77 /ncRNA_class="miRNA" /gene="Mir181c" /gene_synonym="mir-181c; Mirn181c" /product="mmu-miR-181c-3p" /db_xref="miRBase:MIMAT0017068" /db_xref="GeneID:723819" /db_xref="MGI:MGI:3618737" /db_xref="miRBase:MI0000724" ORIGIN
gccaagggtttgggggaacattcaacctgtcggtgagtttgggcagctcagacaaaccatcgaccgttgagtggaccccgaggcctgga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]