GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-04-05 12:38:31, GGRNA.v2 : RefSeq release 228 (Jan, 2025)

LOCUS       NM_020021               1448 bp    mRNA    linear   ROD 19-NOV-2024
DEFINITION  Mus musculus Moloney sarcoma oncogene (Mos), mRNA.
ACCESSION   NM_020021 XM_973427
VERSION     NM_020021.3
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 1448)
  AUTHORS   Adams,D.J., Barlas,B., McIntyre,R.E., Salguero,I., van der
            Weyden,L., Barros,A., Vicente,J.R., Karimpour,N., Haider,A.,
            Ranzani,M., Turner,G., Thompson,N.A., Harle,V., Olvera-Leon,R.,
            Robles-Espinoza,C.D., Speak,A.O., Geisler,N., Weninger,W.J.,
            Geyer,S.H., Hewinson,J., Karp,N.A., Fu,B., Yang,F., Kozik,Z.,
            Choudhary,J., Yu,L., van Ruiten,M.S., Rowland,B.D., Lelliott,C.J.,
            Del Castillo Velasco-Herrera,M., Verstraten,R., Bruckner,L.,
            Henssen,A.G., Rooimans,M.A., de Lange,J., Mohun,T.J., Arends,M.J.,
            Kentistou,K.A., Coelho,P.A., Zhao,Y., Zecchini,H., Perry,J.R.B.,
            Jackson,S.P. and Balmus,G.
  CONSRTM   Sanger Mouse Genetics Project
  TITLE     Genetic determinants of micronucleus formation in vivo
  JOURNAL   Nature 627 (8002), 130-136 (2024)
   PUBMED   38355793
REFERENCE   2  (bases 1 to 1448)
  AUTHORS   Iyyappan,R., Aleshkina,D., Ming,H., Dvoran,M., Kakavand,K.,
            Jansova,D., Del Llano,E., Gahurova,L., Bruce,A.W., Masek,T.,
            Pospisek,M., Horvat,F., Kubelka,M., Jiang,Z. and Susor,A.
  TITLE     The translational oscillation in oocyte and early embryo
            development
  JOURNAL   Nucleic Acids Res 51 (22), 12076-12091 (2023)
   PUBMED   37950888
REFERENCE   3  (bases 1 to 1448)
  AUTHORS   Gindi,N., Grossman,H., Bar-Joseph,H., Miller,I., Nemerovsky,L.,
            Hadas,R., Nevo,N., Galiani,D., Dekel,N. and Shalgi,R.
  TITLE     Fyn and argonaute 2 participate in maternal-mRNA degradation during
            mouse oocyte maturation
  JOURNAL   Cell Cycle 21 (8), 792-804 (2022)
   PUBMED   35104175
REFERENCE   4  (bases 1 to 1448)
  AUTHORS   Jansova,D., Aleshkina,D., Jindrova,A., Iyyappan,R., An,Q., Fan,G.
            and Susor,A.
  TITLE     Single Molecule RNA Localization and Translation in the Mammalian
            Oocyte and Embryo
  JOURNAL   J Mol Biol 433 (19), 167166 (2021)
   PUBMED   34293340
  REMARK    GeneRIF: Single Molecule RNA Localization and Translation in the
            Mammalian Oocyte and Embryo.
REFERENCE   5  (bases 1 to 1448)
  AUTHORS   Chaigne,A., Campillo,C., Gov,N.S., Voituriez,R., Sykes,C.,
            Verlhac,M.H. and Terret,M.E.
  TITLE     A narrow window of cortical tension guides asymmetric spindle
            positioning in the mouse oocyte
  JOURNAL   Nat Commun 6, 6027 (2015)
   PUBMED   25597399
  REMARK    Publication Status: Online-Only
REFERENCE   6  (bases 1 to 1448)
  AUTHORS   Steel,L.F., Telly,D.L., Leonard,J., Rice,B.A., Monks,B. and
            Sawicki,J.A.
  TITLE     Elements in the murine c-mos messenger RNA 5'-untranslated region
            repress translation of downstream coding sequences
  JOURNAL   Cell Growth Differ 7 (10), 1415-1424 (1996)
   PUBMED   8891345
REFERENCE   7  (bases 1 to 1448)
  AUTHORS   Cutting,G.R., Curristin,S., Zoghbi,H., O'Hara,B., Seldin,M.F. and
            Uhl,G.R.
  TITLE     Identification of a putative gamma-aminobutyric acid (GABA)
            receptor subunit rho2 cDNA and colocalization of the genes encoding
            rho2 (GABRR2) and rho1 (GABRR1) to human chromosome 6q14-q21 and
            mouse chromosome 4
  JOURNAL   Genomics 12 (4), 801-806 (1992)
   PUBMED   1315307
REFERENCE   8  (bases 1 to 1448)
  AUTHORS   Birkenmeier,E.H., Schneider,U. and Thurston,S.J.
  TITLE     Fingerprinting genomes by use of PCR with primers that encode
            protein motifs or contain sequences that regulate gene expression
  JOURNAL   Mamm Genome 3 (10), 537-545 (1992)
   PUBMED   1421760
  REMARK    Erratum:[Mamm Genome 1993;4(2):133]
REFERENCE   9  (bases 1 to 1448)
  AUTHORS   Le Roy,H., Simon-Chazottes,D., Montagutelli,X. and Guenet,J.L.
  TITLE     A set of anonymous DNA clones as markers for mouse gene mapping
  JOURNAL   Mamm Genome 3 (4), 244-246 (1992)
   PUBMED   1351769
REFERENCE   10 (bases 1 to 1448)
  AUTHORS   Frankel,W.N., Lee,B.K., Stoye,J.P., Coffin,J.M. and Eicher,E.M.
  TITLE     Characterization of the endogenous nonecotropic murine leukemia
            viruses of NZB/B1NJ and SM/J inbred strains
  JOURNAL   Mamm Genome 2 (2), 110-122 (1992)
   PUBMED   1311971
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AL807387.10.
            
            On Aug 17, 2018 this sequence version replaced NM_020021.2.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript is intronless :: AK133089.1, BC137690.1 [ECO:0000345]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            regulatory uORF        :: PMID: 8891345
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1448              AL807387.10        40913-42360         c
FEATURES             Location/Qualifiers
     source          1..1448
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="4"
                     /map="4 2.16 cM"
     gene            1..1448
                     /gene="Mos"
                     /gene_synonym="c-mos"
                     /note="Moloney sarcoma oncogene"
                     /db_xref="GeneID:17451"
                     /db_xref="MGI:MGI:97052"
     exon            1..1448
                     /gene="Mos"
                     /gene_synonym="c-mos"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    112..114
                     /gene="Mos"
                     /gene_synonym="c-mos"
                     /note="upstream in-frame stop codon"
     CDS             292..1323
                     /gene="Mos"
                     /gene_synonym="c-mos"
                     /EC_number="2.7.11.1"
                     /note="oocyte maturation factor mos; c-mos proto-oncogene;
                     proto-oncogene c-Mos"
                     /codon_start=1
                     /product="proto-oncogene serine/threonine-protein kinase
                     mos"
                     /protein_id="NP_064405.2"
                     /db_xref="CCDS:CCDS38685.1"
                     /db_xref="GeneID:17451"
                     /db_xref="MGI:MGI:97052"
                     /translation="
MPSPLSLCRYLPRELSPSVDSRSCSIPLVAPRKAGKLFLGTTPPRAPGLPRRLAWFSIDWEQVCLMHRLGSGGFGSVYKATYHGVPVAIKQVNKCTKDLRASQRSFWAELNIARLRHDNIVRVVAASTRTPEDSNSLGTIIMEFGGNVTLHQVIYGATRSPEPLSCREQLSLGKCLKYSLDVVNGLLFLHSQSILHLDLKPANILISEQDVCKISDFGCSQKLQDLRCRQASPHHIGGTYTHQAPEILKGEIATPKADIYSFGITLWQMTTREVPYSGEPQYVQYAVVAYNLRPSLAGAVFTASLTGKTLQNIIQSCWEARALQRPGAELLQRDLKAFRGALG"
     misc_feature    466..1296
                     /gene="Mos"
                     /gene_synonym="c-mos"
                     /note="Catalytic domain of the Serine/Threonine kinase,
                     Oocyte maturation factor Mos; Region: STKc_Mos; cd13979"
                     /db_xref="CDD:270881"
     misc_feature    order(496..510,520..522,553..555,559..561,652..654,
                     715..726,736..738,742..744,883..885,889..891,895..900,
                     904..906,937..939,946..948,1003..1014)
                     /gene="Mos"
                     /gene_synonym="c-mos"
                     /note="active site"
                     /db_xref="CDD:270881"
     misc_feature    order(496..510,520..522,553..555,559..561,652..654,
                     715..726,736..738,883..885,889..891,895..900,904..906,
                     937..939)
                     /gene="Mos"
                     /gene_synonym="c-mos"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:270881"
     misc_feature    order(508..510,736..738,742..744,883..885,889..891,
                     895..897,946..948,1003..1014)
                     /gene="Mos"
                     /gene_synonym="c-mos"
                     /note="polypeptide substrate binding site [polypeptide
                     binding]; other site"
                     /db_xref="CDD:270881"
     misc_feature    order(934..981,994..1014)
                     /gene="Mos"
                     /gene_synonym="c-mos"
                     /note="activation loop (A-loop); other site"
                     /db_xref="CDD:270881"
ORIGIN      
actgtttaacgggggaagaagttgctaaggattcactttagctgtgagcaatcgtttcatctgagactgccaggcttcatctgcacccccaaccccacctgacttattttttaaaaaagaaacaccttgtggagtagtgatagcacagatgtggctggttttgagaatcaaggaagaagggaaaggaactgggatgaaggcagcaatcttcagccatgctcccaaacttccctggctgttcctactcatttctccctagtgtctcatgtgactgtcccatctgagggtgtaatgccttcgcctctaagcctgtgtcgctacctccctcgtgagctgtcgccatcggtggactcgcggtcctgcagcattcctttggtggccccgaggaaggcagggaagctcttcctggggaccactcctcctcgggctcccggactgccacgccggctggcctggttctccatagactgggaacaggtatgtctgatgcataggctgggctctggagggtttggctcggtgtataaagccacttaccacggtgttcctgtggccatcaagcaagtaaacaagtgcaccaaggacctacgtgcatcccagcggagtttctgggctgaactgaacattgcaagactacgccacgacaacatagttcgggttgtggctgccagcacgcgcacgcccgaagactccaacagcctaggtaccataatcatggagtttgggggcaacgtgactctacaccaagtcatctacggtgccacccgctcaccggagcctctcagctgcagagaacaactgagtttggggaagtgcctcaagtattccctagatgttgttaacggcctgctttttctccactcacaaagcattttgcacttggacctgaagccagcgaacattttgatcagtgagcaagacgtttgtaagatcagtgacttcggctgctcccagaagctgcaggatctgcggtgccggcaggcgtcccctcaccacatagggggcacgtacacgcaccaagctccggagatcctgaaaggagagattgccacgcccaaagctgacatctactcttttggaatcaccctgtggcagatgaccaccagggaggtgccttactccggcgaacctcagtacgtgcagtatgcagtggttgcctacaatctgcgcccctcactggcaggggcggtgttcaccgcctccctgactggaaagacactgcagaacatcatccagagctgctgggaggcccgcgccctgcagaggccgggtgcagaactgctccaaagggacctcaaggctttccgaggggcactaggctgactccatcgagccgatgtagagataagctttttgtctctgtttatttttttaaagaagtaaggatggtgtggaagaaaacataccactagggcatatttttaggaaataaagttaccacgaacttc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]