2025-04-05 12:38:31, GGRNA.v2 : RefSeq release 228 (Jan, 2025)
LOCUS NM_020021 1448 bp mRNA linear ROD 19-NOV-2024 DEFINITION Mus musculus Moloney sarcoma oncogene (Mos), mRNA. ACCESSION NM_020021 XM_973427 VERSION NM_020021.3 KEYWORDS RefSeq; RefSeq Select. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 1448) AUTHORS Adams,D.J., Barlas,B., McIntyre,R.E., Salguero,I., van der Weyden,L., Barros,A., Vicente,J.R., Karimpour,N., Haider,A., Ranzani,M., Turner,G., Thompson,N.A., Harle,V., Olvera-Leon,R., Robles-Espinoza,C.D., Speak,A.O., Geisler,N., Weninger,W.J., Geyer,S.H., Hewinson,J., Karp,N.A., Fu,B., Yang,F., Kozik,Z., Choudhary,J., Yu,L., van Ruiten,M.S., Rowland,B.D., Lelliott,C.J., Del Castillo Velasco-Herrera,M., Verstraten,R., Bruckner,L., Henssen,A.G., Rooimans,M.A., de Lange,J., Mohun,T.J., Arends,M.J., Kentistou,K.A., Coelho,P.A., Zhao,Y., Zecchini,H., Perry,J.R.B., Jackson,S.P. and Balmus,G. CONSRTM Sanger Mouse Genetics Project TITLE Genetic determinants of micronucleus formation in vivo JOURNAL Nature 627 (8002), 130-136 (2024) PUBMED 38355793 REFERENCE 2 (bases 1 to 1448) AUTHORS Iyyappan,R., Aleshkina,D., Ming,H., Dvoran,M., Kakavand,K., Jansova,D., Del Llano,E., Gahurova,L., Bruce,A.W., Masek,T., Pospisek,M., Horvat,F., Kubelka,M., Jiang,Z. and Susor,A. TITLE The translational oscillation in oocyte and early embryo development JOURNAL Nucleic Acids Res 51 (22), 12076-12091 (2023) PUBMED 37950888 REFERENCE 3 (bases 1 to 1448) AUTHORS Gindi,N., Grossman,H., Bar-Joseph,H., Miller,I., Nemerovsky,L., Hadas,R., Nevo,N., Galiani,D., Dekel,N. and Shalgi,R. TITLE Fyn and argonaute 2 participate in maternal-mRNA degradation during mouse oocyte maturation JOURNAL Cell Cycle 21 (8), 792-804 (2022) PUBMED 35104175 REFERENCE 4 (bases 1 to 1448) AUTHORS Jansova,D., Aleshkina,D., Jindrova,A., Iyyappan,R., An,Q., Fan,G. and Susor,A. TITLE Single Molecule RNA Localization and Translation in the Mammalian Oocyte and Embryo JOURNAL J Mol Biol 433 (19), 167166 (2021) PUBMED 34293340 REMARK GeneRIF: Single Molecule RNA Localization and Translation in the Mammalian Oocyte and Embryo. REFERENCE 5 (bases 1 to 1448) AUTHORS Chaigne,A., Campillo,C., Gov,N.S., Voituriez,R., Sykes,C., Verlhac,M.H. and Terret,M.E. TITLE A narrow window of cortical tension guides asymmetric spindle positioning in the mouse oocyte JOURNAL Nat Commun 6, 6027 (2015) PUBMED 25597399 REMARK Publication Status: Online-Only REFERENCE 6 (bases 1 to 1448) AUTHORS Steel,L.F., Telly,D.L., Leonard,J., Rice,B.A., Monks,B. and Sawicki,J.A. TITLE Elements in the murine c-mos messenger RNA 5'-untranslated region repress translation of downstream coding sequences JOURNAL Cell Growth Differ 7 (10), 1415-1424 (1996) PUBMED 8891345 REFERENCE 7 (bases 1 to 1448) AUTHORS Cutting,G.R., Curristin,S., Zoghbi,H., O'Hara,B., Seldin,M.F. and Uhl,G.R. TITLE Identification of a putative gamma-aminobutyric acid (GABA) receptor subunit rho2 cDNA and colocalization of the genes encoding rho2 (GABRR2) and rho1 (GABRR1) to human chromosome 6q14-q21 and mouse chromosome 4 JOURNAL Genomics 12 (4), 801-806 (1992) PUBMED 1315307 REFERENCE 8 (bases 1 to 1448) AUTHORS Birkenmeier,E.H., Schneider,U. and Thurston,S.J. TITLE Fingerprinting genomes by use of PCR with primers that encode protein motifs or contain sequences that regulate gene expression JOURNAL Mamm Genome 3 (10), 537-545 (1992) PUBMED 1421760 REMARK Erratum:[Mamm Genome 1993;4(2):133] REFERENCE 9 (bases 1 to 1448) AUTHORS Le Roy,H., Simon-Chazottes,D., Montagutelli,X. and Guenet,J.L. TITLE A set of anonymous DNA clones as markers for mouse gene mapping JOURNAL Mamm Genome 3 (4), 244-246 (1992) PUBMED 1351769 REFERENCE 10 (bases 1 to 1448) AUTHORS Frankel,W.N., Lee,B.K., Stoye,J.P., Coffin,J.M. and Eicher,E.M. TITLE Characterization of the endogenous nonecotropic murine leukemia viruses of NZB/B1NJ and SM/J inbred strains JOURNAL Mamm Genome 2 (2), 110-122 (1992) PUBMED 1311971 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AL807387.10. On Aug 17, 2018 this sequence version replaced NM_020021.2. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript is intronless :: AK133089.1, BC137690.1 [ECO:0000345] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on single protein-coding transcript regulatory uORF :: PMID: 8891345 ##RefSeq-Attributes-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-1448 AL807387.10 40913-42360 c FEATURES Location/Qualifiers source 1..1448 /organism="Mus musculus" /mol_type="mRNA" /strain="C57BL/6" /db_xref="taxon:10090" /chromosome="4" /map="4 2.16 cM" gene 1..1448 /gene="Mos" /gene_synonym="c-mos" /note="Moloney sarcoma oncogene" /db_xref="GeneID:17451" /db_xref="MGI:MGI:97052" exon 1..1448 /gene="Mos" /gene_synonym="c-mos" /inference="alignment:Splign:2.1.0" misc_feature 112..114 /gene="Mos" /gene_synonym="c-mos" /note="upstream in-frame stop codon" CDS 292..1323 /gene="Mos" /gene_synonym="c-mos" /EC_number="2.7.11.1" /note="oocyte maturation factor mos; c-mos proto-oncogene; proto-oncogene c-Mos" /codon_start=1 /product="proto-oncogene serine/threonine-protein kinase mos" /protein_id="NP_064405.2" /db_xref="CCDS:CCDS38685.1" /db_xref="GeneID:17451" /db_xref="MGI:MGI:97052" /translation="
MPSPLSLCRYLPRELSPSVDSRSCSIPLVAPRKAGKLFLGTTPPRAPGLPRRLAWFSIDWEQVCLMHRLGSGGFGSVYKATYHGVPVAIKQVNKCTKDLRASQRSFWAELNIARLRHDNIVRVVAASTRTPEDSNSLGTIIMEFGGNVTLHQVIYGATRSPEPLSCREQLSLGKCLKYSLDVVNGLLFLHSQSILHLDLKPANILISEQDVCKISDFGCSQKLQDLRCRQASPHHIGGTYTHQAPEILKGEIATPKADIYSFGITLWQMTTREVPYSGEPQYVQYAVVAYNLRPSLAGAVFTASLTGKTLQNIIQSCWEARALQRPGAELLQRDLKAFRGALG"
misc_feature 466..1296 /gene="Mos" /gene_synonym="c-mos" /note="Catalytic domain of the Serine/Threonine kinase, Oocyte maturation factor Mos; Region: STKc_Mos; cd13979" /db_xref="CDD:270881" misc_feature order(496..510,520..522,553..555,559..561,652..654, 715..726,736..738,742..744,883..885,889..891,895..900, 904..906,937..939,946..948,1003..1014) /gene="Mos" /gene_synonym="c-mos" /note="active site" /db_xref="CDD:270881" misc_feature order(496..510,520..522,553..555,559..561,652..654, 715..726,736..738,883..885,889..891,895..900,904..906, 937..939) /gene="Mos" /gene_synonym="c-mos" /note="ATP binding site [chemical binding]; other site" /db_xref="CDD:270881" misc_feature order(508..510,736..738,742..744,883..885,889..891, 895..897,946..948,1003..1014) /gene="Mos" /gene_synonym="c-mos" /note="polypeptide substrate binding site [polypeptide binding]; other site" /db_xref="CDD:270881" misc_feature order(934..981,994..1014) /gene="Mos" /gene_synonym="c-mos" /note="activation loop (A-loop); other site" /db_xref="CDD:270881" ORIGIN
actgtttaacgggggaagaagttgctaaggattcactttagctgtgagcaatcgtttcatctgagactgccaggcttcatctgcacccccaaccccacctgacttattttttaaaaaagaaacaccttgtggagtagtgatagcacagatgtggctggttttgagaatcaaggaagaagggaaaggaactgggatgaaggcagcaatcttcagccatgctcccaaacttccctggctgttcctactcatttctccctagtgtctcatgtgactgtcccatctgagggtgtaatgccttcgcctctaagcctgtgtcgctacctccctcgtgagctgtcgccatcggtggactcgcggtcctgcagcattcctttggtggccccgaggaaggcagggaagctcttcctggggaccactcctcctcgggctcccggactgccacgccggctggcctggttctccatagactgggaacaggtatgtctgatgcataggctgggctctggagggtttggctcggtgtataaagccacttaccacggtgttcctgtggccatcaagcaagtaaacaagtgcaccaaggacctacgtgcatcccagcggagtttctgggctgaactgaacattgcaagactacgccacgacaacatagttcgggttgtggctgccagcacgcgcacgcccgaagactccaacagcctaggtaccataatcatggagtttgggggcaacgtgactctacaccaagtcatctacggtgccacccgctcaccggagcctctcagctgcagagaacaactgagtttggggaagtgcctcaagtattccctagatgttgttaacggcctgctttttctccactcacaaagcattttgcacttggacctgaagccagcgaacattttgatcagtgagcaagacgtttgtaagatcagtgacttcggctgctcccagaagctgcaggatctgcggtgccggcaggcgtcccctcaccacatagggggcacgtacacgcaccaagctccggagatcctgaaaggagagattgccacgcccaaagctgacatctactcttttggaatcaccctgtggcagatgaccaccagggaggtgccttactccggcgaacctcagtacgtgcagtatgcagtggttgcctacaatctgcgcccctcactggcaggggcggtgttcaccgcctccctgactggaaagacactgcagaacatcatccagagctgctgggaggcccgcgccctgcagaggccgggtgcagaactgctccaaagggacctcaaggctttccgaggggcactaggctgactccatcgagccgatgtagagataagctttttgtctctgtttatttttttaaagaagtaaggatggtgtggaagaaaacataccactagggcatatttttaggaaataaagttaccacgaacttc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]