2025-04-20 02:36:03, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS NM_010057 1128 bp mRNA linear ROD 15-JUN-2024 DEFINITION Mus musculus distal-less homeobox 6 (Dlx6), mRNA. ACCESSION NM_010057 VERSION NM_010057.3 KEYWORDS RefSeq; RefSeq Select. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 1128) AUTHORS Cheffer,A., Garcia-Miralles,M., Maier,E., Akol,I., Franz,H., Srinivasan,V.S.V. and Vogel,T. TITLE DOT1L deletion impairs the development of cortical parvalbumin-expressing interneurons JOURNAL Cereb Cortex 33 (19), 10272-10285 (2023) PUBMED 37566909 REFERENCE 2 (bases 1 to 1128) AUTHORS Kurihara,Y., Ekimoto,T., Gordon,C.T., Uchijima,Y., Sugiyama,R., Kitazawa,T., Iwase,A., Kotani,R., Asai,R., Pingault,V., Ikeguchi,M., Amiel,J. and Kurihara,H. TITLE Mandibulofacial dysostosis with alopecia results from ETAR gain-of-function mutations via allosteric effects on ligand binding JOURNAL J Clin Invest 133 (4), e151536 (2023) PUBMED 36637912 REMARK Publication Status: Online-Only REFERENCE 3 (bases 1 to 1128) AUTHORS Mullen,R.D., Bellessort,B., Levi,G. and Behringer,R.R. TITLE Distal-less homeobox genes Dlx5/6 regulate Mullerian duct regression JOURNAL Front Endocrinol (Lausanne) 13, 916173 (2022) PUBMED 35909540 REMARK GeneRIF: Distal-less homeobox genes Dlx5/6 regulate Mullerian duct regression. Publication Status: Online-Only REFERENCE 4 (bases 1 to 1128) AUTHORS Gu,R., Zhang,S., Saha,S.K., Ji,Y., Reynolds,K., McMahon,M., Sun,B., Islam,M., Trainor,P.A., Chen,Y., Xu,Y., Chai,Y., Burkart-Waco,D. and Zhou,C.J. TITLE Single-cell transcriptomic signatures and gene regulatory networks modulated by Wls in mammalian midline facial formation and clefts JOURNAL Development 149 (14) (2022) PUBMED 35781558 REFERENCE 5 (bases 1 to 1128) AUTHORS Aouci,R., El Soudany,M., Maakoul,Z., Fontaine,A., Kurihara,H., Levi,G. and Narboux-Neme,N. TITLE Dlx5/6 Expression Levels in Mouse GABAergic Neurons Regulate Adult Parvalbumin Neuronal Density and Anxiety/Compulsive Behaviours JOURNAL Cells 11 (11), 1739 (2022) PUBMED 35681437 REMARK GeneRIF: Dlx5/6 Expression Levels in Mouse GABAergic Neurons Regulate Adult Parvalbumin Neuronal Density and Anxiety/Compulsive Behaviours. Publication Status: Online-Only REFERENCE 6 (bases 1 to 1128) AUTHORS Anderson,S.A., Qiu,M., Bulfone,A., Eisenstat,D.D., Meneses,J., Pedersen,R. and Rubenstein,J.L. TITLE Mutations of the homeobox genes Dlx-1 and Dlx-2 disrupt the striatal subventricular zone and differentiation of late born striatal neurons JOURNAL Neuron 19 (1), 27-37 (1997) PUBMED 9247261 REFERENCE 7 (bases 1 to 1128) AUTHORS Qiu,M., Bulfone,A., Ghattas,I., Meneses,J.J., Christensen,L., Sharpe,P.T., Presley,R., Pedersen,R.A. and Rubenstein,J.L. TITLE Role of the Dlx homeobox genes in proximodistal patterning of the branchial arches: mutations of Dlx-1, Dlx-2, and Dlx-1 and -2 alter morphogenesis of proximal skeletal and soft tissue structures derived from the first and second arches JOURNAL Dev Biol 185 (2), 165-184 (1997) PUBMED 9187081 REFERENCE 8 (bases 1 to 1128) AUTHORS Stock,D.W., Ellies,D.L., Zhao,Z., Ekker,M., Ruddle,F.H. and Weiss,K.M. TITLE The evolution of the vertebrate Dlx gene family JOURNAL Proc Natl Acad Sci U S A 93 (20), 10858-10863 (1996) PUBMED 8855272 REFERENCE 9 (bases 1 to 1128) AUTHORS Chen,X., Li,X., Wang,W. and Lufkin,T. TITLE Dlx5 and Dlx6: an evolutionary conserved pair of murine homeobox genes expressed in the embryonic skeleton JOURNAL Ann N Y Acad Sci 785, 38-47 (1996) PUBMED 8702182 REFERENCE 10 (bases 1 to 1128) AUTHORS Simeone,A., Acampora,D., Pannese,M., D'Esposito,M., Stornaiuolo,A., Gulisano,M., Mallamaci,A., Kastury,K., Druck,T., Huebner,K. et al. TITLE Cloning and characterization of two members of the vertebrate Dlx gene family JOURNAL Proc Natl Acad Sci U S A 91 (6), 2250-2254 (1994) PUBMED 7907794 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AC122240.4. On Jan 19, 2024 this sequence version replaced NM_010057.2. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AF022078.1, SRR1660815.392232.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMN00849374, SAMN00849382 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on single protein-coding transcript ##RefSeq-Attributes-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-556 AC122240.4 106507-107062 557-750 AC122240.4 108313-108506 751-1039 AC122240.4 110276-110564 1040-1128 AC122240.4 111112-111200 FEATURES Location/Qualifiers source 1..1128 /organism="Mus musculus" /mol_type="mRNA" /strain="C57BL/6" /db_xref="taxon:10090" /chromosome="6" /map="6 2.83 cM" gene 1..1128 /gene="Dlx6" /note="distal-less homeobox 6" /db_xref="GeneID:13396" /db_xref="MGI:MGI:101927" exon 1..556 /gene="Dlx6" /inference="alignment:Splign:2.1.0" misc_feature 64..66 /gene="Dlx6" /note="upstream in-frame stop codon" CDS 109..1002 /gene="Dlx6" /codon_start=1 /product="homeobox protein DLX-6" /protein_id="NP_034187.1" /db_xref="CCDS:CCDS51719.1" /db_xref="GeneID:13396" /db_xref="MGI:MGI:101927" /translation="
MMTMTTMADGLEGQDSSKSAFMEFGQQQQQQQQQQQQQQQQQQQQQQPPPPPPPPPPQPHSQQTSPAMAGAHYPLHCLHSAAAAAAAAGSHHHHHQHHHHGSPYASSGGNSYNHRSLAAYPYMSHSQHSPYLQSYHNSSAAAQTRGDDTDQQKTTVIENGEIRFNGKGKKIRKPRTIYSSLQLQALNHRFQQTQYLALPERAELAASLGLTQTQVKIWFQNKRSKFKKLLKQGSNPHESDPLPGSAALSPRSPALPPVWDVSASAKGVSMPPNSYMPGYSHWYSSPHQDTMQRPQMM"
misc_feature 475..945 /gene="Dlx6" /note="Homeodomain-containing transcription factor [Transcription]; Region: COG5576" /db_xref="CDD:227863" misc_feature 622..792 /gene="Dlx6" /note="Region: Homeodomain; pfam00046" /db_xref="CDD:459649" exon 557..750 /gene="Dlx6" /inference="alignment:Splign:2.1.0" exon 751..1039 /gene="Dlx6" /inference="alignment:Splign:2.1.0" exon 1040..1128 /gene="Dlx6" /inference="alignment:Splign:2.1.0" regulatory 1109..1114 /regulatory_class="polyA_signal_sequence" /gene="Dlx6" /note="hexamer: ATTACA" polyA_site 1128 /gene="Dlx6" /note="major polyA site" ORIGIN
caaggatcccgggagctaaggtggctgcaaaggggagagcggtgcgagccaagtgggggagggtgaaagaaacccgggagaaggctttctccagcccccaaagttttgatgatgaccatgactacgatggctgacggcttggaaggccaggactcgtccaaatccgccttcatggagttcgggcagcagcaacagcagcagcagcaacaacagcagcagcaacagcagcagcagcagcagcaacagcagccgccgccgccgccaccgccgccgccgccgcagccgcactcgcagcagacctccccggccatggcaggcgcacattaccctctgcactgcttgcactcggccgcggcggcggcggcggcggccggctcccaccatcaccaccaccagcaccaccaccacggctcgccctacgcgtcgagcggaggcaactcctacaaccaccgatcgctcgccgcctacccctacatgagccactcgcagcacagcccttacctccagtcctaccacaacagcagcgcggccgcccagacgcgcggggacgacacagatcaacaaaaaacgacagtgatcgaaaacggggaaatcaggttcaacggaaaggggaaaaagattcggaagcctcggaccatttattccagcctgcagctccaggctttaaaccatcgctttcagcagactcaatacctggcccttcccgagagagccgaactggctgcttccttaggactgacacaaacacaggtgaagatatggtttcagaataagcgctctaagtttaagaaattgctgaagcagggtagtaacccacacgagagtgaccccctcccgggttcagcagccctgtcaccacgatcaccagccctgcctccagtgtgggacgtttctgcctctgccaagggcgtcagtatgcctcccaacagctacatgccggggtattcacactggtattcctcaccacaccaggacaccatgcagagaccacagatgatgtgacttctctgagtgaacgcctacggagcttctgaaggagacattctccaccggcagaagaatctgcacaaacatggcagcatttttacttgtttaatgagtttaagacattacatgataaaaaacaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]