LOCUS       NM_007674               1595 bp    mRNA    linear   ROD 01-JUN-2024
DEFINITION  Mus musculus caudal type homeobox 4 (Cdx4), mRNA.
ACCESSION   NM_007674
VERSION     NM_007674.3
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 1595)
  AUTHORS   Kim,S.E., Chothani,P.J., Shaik,R., Pollard,W. and Finnell,R.H.
  TITLE     Pax3 lineage-specific deletion of Gpr161 is associated with spinal
            neural tube and craniofacial malformations during embryonic
            development
  JOURNAL   Dis Model Mech 16 (11) (2023)
   PUBMED   37885410
REFERENCE   2  (bases 1 to 1595)
  AUTHORS   Zhao,T., McMahon,M., Reynolds,K., Saha,S.K., Stokes,A. and
            Zhou,C.J.
  TITLE     The role of Lrp6-mediated Wnt/beta-catenin signaling in the
            development and intervention of spinal neural tube defects in mice
  JOURNAL   Dis Model Mech 15 (6) (2022)
   PUBMED   35514236
REFERENCE   3  (bases 1 to 1595)
  AUTHORS   Garriock,R.J., Chalamalasetty,R.B., Zhu,J., Kennedy,M.W., Kumar,A.,
            Mackem,S. and Yamaguchi,T.P.
  TITLE     A dorsal-ventral gradient of Wnt3a/beta-catenin signals controls
            mouse hindgut extension and colon formation
  JOURNAL   Development 147 (8) (2020)
   PUBMED   32156757
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 1595)
  AUTHORS   Foley,T.E., Hess,B., Savory,J.G.A., Ringuette,R. and Lohnes,D.
  TITLE     Role of Cdx factors in early mesodermal fate decisions
  JOURNAL   Development 146 (7) (2019)
   PUBMED   30936115
  REMARK    Publication Status: Online-Only
REFERENCE   5  (bases 1 to 1595)
  AUTHORS   Metzis,V., Steinhauser,S., Pakanavicius,E., Gouti,M., Stamataki,D.,
            Ivanovitch,K., Watson,T., Rayon,T., Mousavy Gharavy,S.N.,
            Lovell-Badge,R., Luscombe,N.M. and Briscoe,J.
  TITLE     Nervous System Regionalization Entails Axial Allocation before
            Neural Differentiation
  JOURNAL   Cell 175 (4), 1105-1118 (2018)
   PUBMED   30343898
REFERENCE   6  (bases 1 to 1595)
  AUTHORS   Winnier,G., Blessing,M., Labosky,P.A. and Hogan,B.L.
  TITLE     Bone morphogenetic protein-4 is required for mesoderm formation and
            patterning in the mouse
  JOURNAL   Genes Dev 9 (17), 2105-2116 (1995)
   PUBMED   7657163
REFERENCE   7  (bases 1 to 1595)
  AUTHORS   Horn,J.M. and Ashworth,A.
  TITLE     A member of the caudal family of homeobox genes maps to the
            X-inactivation centre region of the mouse and human X chromosomes
  JOURNAL   Hum Mol Genet 4 (6), 1041-1047 (1995)
   PUBMED   7655457
REFERENCE   8  (bases 1 to 1595)
  AUTHORS   Conlon,F.L., Wright,C.V. and Robertson,E.J.
  TITLE     Effects of the TWis mutation on notochord formation and mesodermal
            patterning
  JOURNAL   Mech Dev 49 (3), 201-209 (1995)
   PUBMED   7734393
REFERENCE   9  (bases 1 to 1595)
  AUTHORS   Gamer,L.W. and Wright,C.V.
  TITLE     Murine Cdx-4 bears striking similarities to the Drosophila caudal
            gene in its homeodomain sequence and early expression pattern
  JOURNAL   Mech Dev 43 (1), 71-81 (1993)
   PUBMED   7902125
REFERENCE   10 (bases 1 to 1595)
  AUTHORS   Candia,A.F., Hu,J., Crosby,J., Lalley,P.A., Noden,D., Nadeau,J.H.
            and Wright,C.V.
  TITLE     Mox-1 and Mox-2 define a novel homeobox gene subfamily and are
            differentially expressed during early mesodermal patterning in
            mouse embryos
  JOURNAL   Development 116 (4), 1123-1136 (1992)
   PUBMED   1363541
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AL669964.18.
            
            On Apr 27, 2007 this sequence version replaced NM_007674.2.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: L08061.1, BC119158.1 [ECO:0000332]
            RNAseq introns              :: mixed sample support SAMN00849379,
                                           SAMN00849386 [ECO:0006172]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-658               AL669964.18        15548-16205
            659-804             AL669964.18        22159-22304
            805-1595            AL669964.18        23584-24374
FEATURES             Location/Qualifiers
     source          1..1595
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="X"
                     /map="X 46.06 cM"
     gene            1..1595
                     /gene="Cdx4"
                     /gene_synonym="Cdx-3; Cdx-4; Cdx3"
                     /note="caudal type homeobox 4"
                     /db_xref="GeneID:12592"
                     /db_xref="MGI:MGI:88362"
     exon            1..658
                     /gene="Cdx4"
                     /gene_synonym="Cdx-3; Cdx-4; Cdx3"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    133..135
                     /gene="Cdx4"
                     /gene_synonym="Cdx-3; Cdx-4; Cdx3"
                     /note="upstream in-frame stop codon"
     CDS             163..1011
                     /gene="Cdx4"
                     /gene_synonym="Cdx-3; Cdx-4; Cdx3"
                     /note="caudal-type homeobox protein 4; caudal type homeo
                     box 4"
                     /codon_start=1
                     /product="homeobox protein CDX-4"
                     /protein_id="NP_031700.1"
                     /db_xref="CCDS:CCDS30328.1"
                     /db_xref="GeneID:12592"
                     /db_xref="MGI:MGI:88362"
                     /translation="

MYGSCLLEKEAGMYPGTLRSPGGSSTAGVGTSGGSGSPLPASNFTAAPVYPHYVGYPHMSNMDPHGPSLGAWSSPYSPPREDWSTYPGPPSTMGTVPMNDMTSPVFGSPDYSTLGPTSGASNGGSLPDAASESLVSLDSGTSGATSPSRSRHSPYAWMRKTVQVTGKTRTKEKYRVVYTDHQRLELEKEFHCNRYITIRRKSELAVNLGLSERQVKIWFQNRRAKERKMIKKKISQFENTGGSVQSDSGSISPGELPNAFFTTPSAVRGFQPIEIQQVIVSE"

     misc_feature    199..666
                     /gene="Cdx4"
                     /gene_synonym="Cdx-3; Cdx-4; Cdx3"
                     /note="Caudal like protein activation region; Region:
                     Caudal_act; pfam04731"
                     /db_xref="CDD:461413"
     misc_feature    199..270
                     /gene="Cdx4"
                     /gene_synonym="Cdx-3; Cdx-4; Cdx3"
                     /note="propagated from UniProtKB/Swiss-Prot (Q07424.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    454..630
                     /gene="Cdx4"
                     /gene_synonym="Cdx-3; Cdx-4; Cdx3"
                     /note="propagated from UniProtKB/Swiss-Prot (Q07424.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    679..846
                     /gene="Cdx4"
                     /gene_synonym="Cdx-3; Cdx-4; Cdx3"
                     /note="Region: Homeodomain; pfam00046"
                     /db_xref="CDD:459649"
     exon            659..804
                     /gene="Cdx4"
                     /gene_synonym="Cdx-3; Cdx-4; Cdx3"
                     /inference="alignment:Splign:2.1.0"
     exon            805..1595
                     /gene="Cdx4"
                     /gene_synonym="Cdx-3; Cdx-4; Cdx3"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

gggtaggaaaggaaggatggagtagtccgagccgcgcagaggagctagcagcgctactagtgctgaccgttgatagtctcttgcgtctcaaactcgggttggcgctaagtttacagggacctcaggatggcttaaggggcaacttcttctatccaagtcaccatgtatggaagctgccttttagaaaaagaagcgggcatgtacccaggcactctcaggagccctggaggaagcagtacagccggagtgggcacctctgggggcagtggtagtcctctgcctgcctccaactttactgcagccccagtttacccacactacgtgggttaccctcatatgtccaacatggatcctcacgggccttcgctgggagcctggagctcaccctacagtccgccccgggaagactggagtacataccctgggccgcccagtacaatgggcacagtgcccatgaatgacatgacctccccagttttcggatccccagactacagcactctgggccccaccagcggtgcaagcaacggcggtagcttgccagacgcggccagcgagtcactggtttctcttgactccggcacctcaggcgccacttctcccagcaggagccgtcacagcccctacgcatggatgcgcaaaactgtgcaggtgacggggaaaaccaggacaaaagaaaagtatcgtgtggtctacacagatcatcaacggctggagctggaaaaggaatttcactgcaatagatacatcaccatcaggaggaagtcagagctggcagttaacctgggcctttctgagagacaggtgaaaatctggtttcagaatcgcagagccaaggagaggaagatgataaaaaagaaaatctcccagtttgagaacactggaggttccgtgcaaagtgactctggctccatcagccccggagaactgcctaacgctttcttcaccactccatctgctgtccgtggatttcagccaatcgagatacagcaggtcatagtttctgaatgaaacaggagcagagaaacggaagcatccttcctgttacagtgtctctttggcctctaagctaacagcagggcagttgagattggatataattccttacaagacacaattccaaacaagtagacacacgatgagttggagatatttcagaagactctaatattcagaaaccatccccagaccactcttattccatgctgtcatatgggggctgggcaaaaagctgtgtgaaaagctttgctccttaaagtctagactcaagagcccttgaaactttgttcacaatttcagaaacttgtttgtgcatatgctcttgtatttgttatttgattttggtctttttagggaataggagtaaagtaagcataaatttctctatctggaggtatcttttggcgaagaaattaaaaaacaaccagttttacaagataactttgtaaaacagcatcaggaggtgattacaaatctattgccattggttaattaaatgaagatcatttttcccattgaataatactcacatgctatcaattacctagccatagaacttagaagatttatctatttcaaatcttgtcaaaacaatg

//