2025-09-19 03:07:03, GGRNA.v2 : RefSeq release 231 (Jul, 2025)
LOCUS NM_001419958 1389 bp mRNA linear ROD 05-MAY-2025 DEFINITION Mus musculus serine (or cysteine) peptidase inhibitor, clade C (antithrombin), member 1 (Serpinc1), transcript variant 5, mRNA. ACCESSION NM_001419958 VERSION NM_001419958.1 KEYWORDS RefSeq. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 1389) AUTHORS Iwako,H., Tashiro,H., Okimoto,S., Yamaguchi,M., Abe,T., Kuroda,S., Kobayashi,T. and Ohdan,H. TITLE Antithrombin Insufficiency Promotes Susceptibility to Liver Tumorigenesis JOURNAL J Surg Res 236, 198-208 (2019) PUBMED 30694755 REMARK GeneRIF: Tumor size and the number of diethylnitrosamine and carbon tetrachloride-induced liver tumors significantly increased in antithrombin (AT)-insufficient mice compared with the wild-type mice. AT insufficiency led to increased susceptibility to liver tumorigenesis by increasing hepatic inflammation. REFERENCE 2 (bases 1 to 1389) AUTHORS Gould,T.W., Dominguez,B., de Winter,F., Yeo,G.W., Liu,P., Sundararaman,B., Stark,T., Vu,A., Degen,J.L., Lin,W. and Lee,K.F. TITLE Glial cells maintain synapses by inhibiting an activity-dependent retrograde protease signal JOURNAL PLoS Genet 15 (3), e1007948 (2019) PUBMED 30870413 REMARK GeneRIF: Trancriptomic analysis shows that expression of the antithrombins serpin C1 and D1 is significantly reduced in Schwann cell-deficient mice. In the absence of peripheral neuromuscular activity, neurodegeneration is completely blocked, and expression of prothrombin in muscle is markedly reduced. Publication Status: Online-Only REFERENCE 3 (bases 1 to 1389) AUTHORS Heit,C., Jackson,B.C., McAndrews,M., Wright,M.W., Thompson,D.C., Silverman,G.A., Nebert,D.W. and Vasiliou,V. TITLE Update of the human and mouse SERPIN gene superfamily JOURNAL Hum Genomics 7 (1), 22 (2013) PUBMED 24172014 REMARK Review article Publication Status: Online-Only REFERENCE 4 (bases 1 to 1389) AUTHORS Safdar,H., Cheung,K.L., Salvatori,D., Versteeg,H.H., Laghmani el,H., Wagenaar,G.T., Reitsma,P.H. and van Vlijmen,B.J. TITLE Acute and severe coagulopathy in adult mice following silencing of hepatic antithrombin and protein C production JOURNAL Blood 121 (21), 4413-4416 (2013) PUBMED 23550037 REMARK GeneRIF: RNA interference of Serpinc1 and/or Proc allows for evaluation of the function of these genes in vivo and provides a novel, controlled mouse model for spontaneous venous thrombosis. REFERENCE 5 (bases 1 to 1389) AUTHORS Naba,A., Clauser,K.R., Hoersch,S., Liu,H., Carr,S.A. and Hynes,R.O. TITLE The matrisome: in silico definition and in vivo characterization by proteomics of normal and tumor extracellular matrices JOURNAL Mol Cell Proteomics 11 (4), M111.014647 (2012) PUBMED 22159717 REFERENCE 6 (bases 1 to 1389) AUTHORS Wu,J.K., Sheffield,W.P. and Blajchman,M.A. TITLE Molecular cloning and cell-free expression of mouse antithrombin III JOURNAL Thromb Haemost 68 (3), 291-296 (1992) PUBMED 1440494 REFERENCE 7 (bases 1 to 1389) AUTHORS Serikawa,T., Montagutelli,X., Simon-Chazottes,D. and Guenet,J.L. TITLE Polymorphisms revealed by PCR with single, short-sized, arbitrary primers are reliable markers for mouse and rat gene mapping JOURNAL Mamm Genome 3 (2), 65-72 (1992) PUBMED 1617216 REFERENCE 8 (bases 1 to 1389) AUTHORS Singh,G., Kaur,S., Stock,J.L., Jenkins,N.A., Gilbert,D.J., Copeland,N.G. and Potter,S.S. TITLE Identification of 10 murine homeobox genes JOURNAL Proc Natl Acad Sci U S A 88 (23), 10706-10710 (1991) PUBMED 1683707 REFERENCE 9 (bases 1 to 1389) AUTHORS Siracusa,L.D., Rosner,M.H., Vigano,M.A., Gilbert,D.J., Staudt,L.M., Copeland,N.G. and Jenkins,N.A. TITLE Chromosomal location of the octamer transcription factors, Otf-1, Otf-2, and Otf-3, defines multiple Otf-3-related sequences dispersed in the mouse genome JOURNAL Genomics 10 (2), 313-326 (1991) PUBMED 1676977 REFERENCE 10 (bases 1 to 1389) AUTHORS Allen,J.D., Lints,T., Jenkins,N.A., Copeland,N.G., Strasser,A., Harvey,R.P. and Adams,J.M. TITLE Novel murine homeo box gene on chromosome 1 expressed in specific hematopoietic lineages and during embryogenesis JOURNAL Genes Dev 5 (4), 509-520 (1991) PUBMED 1672660 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AC119204.7 and AC163327.2. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: ERR2844020.2189244.1, ERR2680379.383855.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMN01164134, SAMN01164135 [ECO:0000348] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-93 AC119204.7 6088-6180 c 94-463 AC119204.7 3923-4292 c 464-679 AC119204.7 60-275 c 680-1070 AC163327.2 79571-79961 1071-1135 AC163327.2 82210-82274 1136-1389 AC163327.2 84508-84761 FEATURES Location/Qualifiers source 1..1389 /organism="Mus musculus" /mol_type="mRNA" /strain="C57BL/6" /db_xref="taxon:10090" /chromosome="1" /map="1 69.75 cM" gene 1..1389 /gene="Serpinc1" /gene_synonym="At-3; At3; ATIII" /note="serine (or cysteine) peptidase inhibitor, clade C (antithrombin), member 1" /db_xref="GeneID:11905" /db_xref="MGI:MGI:88095" exon 1..93 /gene="Serpinc1" /gene_synonym="At-3; At3; ATIII" /inference="alignment:Splign:2.1.0" CDS 53..1312 /gene="Serpinc1" /gene_synonym="At-3; At3; ATIII" /note="isoform 4 precursor is encoded by transcript variant 5; serpin peptidase inhibitor, clade C, member 1; antithrombin-III; serpin C1; serine (or cysteine) proteinase inhibitor, clade C (antithrombin), member 1; anti-thrombin 3" /codon_start=1 /product="antithrombin-III isoform 4 precursor" /protein_id="NP_001406887.1" /db_xref="GeneID:11905" /db_xref="MGI:MGI:88095" /translation="
MYSPGAGSGAAGERKLCLLSLLLIGALGCAICHGNPVDDICIAKPRDIPVNPLCIYRSPGKKATEEDGSEQKVPEATNRRVWELSKANSRFATNFYQHLADSKNDNDNIFLSPLSISTAFAMTKLGACNDTLKQLMEVFKFDTISEKTSDQIHFFFAKLNCRLYRKANKSSDLVSANRLFGDKSLTFNESYQDVSEVVYGAKLQPLDFKGLWKSKFSPENTRKEPFYKVDGQSCPVPMMYQEGKFKYRRVAEGTQVLELPFKGDDITMVLILPKPEKSLAKVEQELTPELLQEWLDELSETMLVVHMPRFRTEDGFSLKEQLQDMGLIDLFSPEKSQLPGIVAGGRDDLYVSDAFHKAFLEVNEEGSEAAASTSVVITGRSLNPNRVTFKANRPFLVLIREVALNTIIFMGRVANPCVN"
sig_peptide 53..154 /gene="Serpinc1" /gene_synonym="At-3; At3; ATIII" /inference="COORDINATES: ab initio prediction:SignalP:6.0" misc_feature 263..1306 /gene="Serpinc1" /gene_synonym="At-3; At3; ATIII" /note="SERine Proteinase INhibitors (serpin) family; Region: serpin; cl38926" /db_xref="CDD:476815" misc_feature order(1148..1180,1232..1234) /gene="Serpinc1" /gene_synonym="At-3; At3; ATIII" /note="reactive center loop (RCL); other site" /db_xref="CDD:381000" exon 94..463 /gene="Serpinc1" /gene_synonym="At-3; At3; ATIII" /inference="alignment:Splign:2.1.0" exon 464..679 /gene="Serpinc1" /gene_synonym="At-3; At3; ATIII" /inference="alignment:Splign:2.1.0" exon 680..1070 /gene="Serpinc1" /gene_synonym="At-3; At3; ATIII" /inference="alignment:Splign:2.1.0" exon 1071..1135 /gene="Serpinc1" /gene_synonym="At-3; At3; ATIII" /inference="alignment:Splign:2.1.0" exon 1136..1389 /gene="Serpinc1" /gene_synonym="At-3; At3; ATIII" /inference="alignment:Splign:2.1.0" regulatory 1368..1373 /regulatory_class="polyA_signal_sequence" /gene="Serpinc1" /gene_synonym="At-3; At3; ATIII" /note="hexamer: AATAAA" polyA_site 1389 /gene="Serpinc1" /gene_synonym="At-3; At3; ATIII" /note="major polyA site" ORIGIN
agttttcggagtgatcgtctcagtcagcaccatctctgtaggagcatcggccatgtattcccctggggcaggaagtggggctgctggtgagaggaagctttgtctcctctctctgctcctcatcggtgccttgggctgtgctatctgtcacggaaaccctgtggacgacatctgcatagcgaagccccgagacatccccgtgaatcccttgtgcatttaccgctcccctgggaagaaggccaccgaggaggatggctcagagcagaaggttccagaagccaccaaccggcgggtctgggaactgtccaaggccaattcgcgatttgccactaacttctaccagcacctggcagactccaagaatgacaacgacaacattttcctgtcacccttgagcatctccactgcttttgctatgaccaagctgggtgcctgtaacgacactctcaagcagctgatggaggtttttaaatttgataccatctccgagaagacatccgaccagatccacttcttctttgccaaactgaactgccgactctatcgaaaagccaacaagtcctctgacttggtatcagccaaccgcctttttggagacaaatccctcaccttcaacgagagctatcaagatgttagtgaggttgtctatggagccaagctccagcccctggacttcaagggcctgtggaagtcaaagttcagccctgagaacacaaggaaggaaccgttctataaggtcgatgggcagtcatgcccagtgcctatgatgtaccaggaaggcaaattcaaataccggcgcgtggcagagggcacccaggtgctagagctgcccttcaagggggatgacatcaccatggtgctcatcctgcccaagcctgagaagagcctggccaaggtggagcaggagctcaccccagagctgctgcaggagtggctggatgagctgtcagagactatgcttgtggtccacatgccccgcttccgcaccgaggatggcttcagtctgaaggagcagctgcaagacatgggcctcattgatctcttcagccctgaaaagtcccaactcccagggatcgttgctggaggcagggacgacctctatgtctccgacgcattccacaaagcatttcttgaggtaaatgaggaaggcagtgaagcagcagcgagtacttctgtcgtgattactggccggtcactgaaccccaatagggtgaccttcaaggccaacaggcccttcctggttcttataagggaagttgcactgaacactattatattcatggggagagtggctaatccttgtgtgaactaaaatattcttaatctttgcaccttttcctactttggtgtttgtgaatagaagtaaaaataaatacgactgccacctca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]