GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-07-03 11:08:03, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       NM_001419958            1389 bp    mRNA    linear   ROD 14-JUN-2024
DEFINITION  Mus musculus serine (or cysteine) peptidase inhibitor, clade C
            (antithrombin), member 1 (Serpinc1), transcript variant 5, mRNA.
ACCESSION   NM_001419958
VERSION     NM_001419958.1
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 1389)
  AUTHORS   Iwako,H., Tashiro,H., Okimoto,S., Yamaguchi,M., Abe,T., Kuroda,S.,
            Kobayashi,T. and Ohdan,H.
  TITLE     Antithrombin Insufficiency Promotes Susceptibility to Liver
            Tumorigenesis
  JOURNAL   J Surg Res 236, 198-208 (2019)
   PUBMED   30694755
  REMARK    GeneRIF: Tumor size and the number of diethylnitrosamine and carbon
            tetrachloride-induced liver tumors significantly increased in
            antithrombin (AT)-insufficient mice compared with the wild-type
            mice. AT insufficiency led to increased susceptibility to liver
            tumorigenesis by increasing hepatic inflammation.
REFERENCE   2  (bases 1 to 1389)
  AUTHORS   Gould,T.W., Dominguez,B., de Winter,F., Yeo,G.W., Liu,P.,
            Sundararaman,B., Stark,T., Vu,A., Degen,J.L., Lin,W. and Lee,K.F.
  TITLE     Glial cells maintain synapses by inhibiting an activity-dependent
            retrograde protease signal
  JOURNAL   PLoS Genet 15 (3), e1007948 (2019)
   PUBMED   30870413
  REMARK    GeneRIF: Trancriptomic analysis shows that expression of the
            antithrombins serpin C1 and D1 is significantly reduced in Schwann
            cell-deficient mice. In the absence of peripheral neuromuscular
            activity, neurodegeneration is completely blocked, and expression
            of prothrombin in muscle is markedly reduced.
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1389)
  AUTHORS   Heit,C., Jackson,B.C., McAndrews,M., Wright,M.W., Thompson,D.C.,
            Silverman,G.A., Nebert,D.W. and Vasiliou,V.
  TITLE     Update of the human and mouse SERPIN gene superfamily
  JOURNAL   Hum Genomics 7 (1), 22 (2013)
   PUBMED   24172014
  REMARK    Review article
            Publication Status: Online-Only
REFERENCE   4  (bases 1 to 1389)
  AUTHORS   Safdar,H., Cheung,K.L., Salvatori,D., Versteeg,H.H., Laghmani
            el,H., Wagenaar,G.T., Reitsma,P.H. and van Vlijmen,B.J.
  TITLE     Acute and severe coagulopathy in adult mice following silencing of
            hepatic antithrombin and protein C production
  JOURNAL   Blood 121 (21), 4413-4416 (2013)
   PUBMED   23550037
  REMARK    GeneRIF: RNA interference of Serpinc1 and/or Proc allows for
            evaluation of the function of these genes in vivo and provides a
            novel, controlled mouse model for spontaneous venous thrombosis.
REFERENCE   5  (bases 1 to 1389)
  AUTHORS   Naba,A., Clauser,K.R., Hoersch,S., Liu,H., Carr,S.A. and Hynes,R.O.
  TITLE     The matrisome: in silico definition and in vivo characterization by
            proteomics of normal and tumor extracellular matrices
  JOURNAL   Mol Cell Proteomics 11 (4), M111.014647 (2012)
   PUBMED   22159717
REFERENCE   6  (bases 1 to 1389)
  AUTHORS   Wu,J.K., Sheffield,W.P. and Blajchman,M.A.
  TITLE     Molecular cloning and cell-free expression of mouse antithrombin
            III
  JOURNAL   Thromb Haemost 68 (3), 291-296 (1992)
   PUBMED   1440494
REFERENCE   7  (bases 1 to 1389)
  AUTHORS   Serikawa,T., Montagutelli,X., Simon-Chazottes,D. and Guenet,J.L.
  TITLE     Polymorphisms revealed by PCR with single, short-sized, arbitrary
            primers are reliable markers for mouse and rat gene mapping
  JOURNAL   Mamm Genome 3 (2), 65-72 (1992)
   PUBMED   1617216
REFERENCE   8  (bases 1 to 1389)
  AUTHORS   Singh,G., Kaur,S., Stock,J.L., Jenkins,N.A., Gilbert,D.J.,
            Copeland,N.G. and Potter,S.S.
  TITLE     Identification of 10 murine homeobox genes
  JOURNAL   Proc Natl Acad Sci U S A 88 (23), 10706-10710 (1991)
   PUBMED   1683707
REFERENCE   9  (bases 1 to 1389)
  AUTHORS   Siracusa,L.D., Rosner,M.H., Vigano,M.A., Gilbert,D.J., Staudt,L.M.,
            Copeland,N.G. and Jenkins,N.A.
  TITLE     Chromosomal location of the octamer transcription factors, Otf-1,
            Otf-2, and Otf-3, defines multiple Otf-3-related sequences
            dispersed in the mouse genome
  JOURNAL   Genomics 10 (2), 313-326 (1991)
   PUBMED   1676977
REFERENCE   10 (bases 1 to 1389)
  AUTHORS   Allen,J.D., Lints,T., Jenkins,N.A., Copeland,N.G., Strasser,A.,
            Harvey,R.P. and Adams,J.M.
  TITLE     Novel murine homeo box gene on chromosome 1 expressed in specific
            hematopoietic lineages and during embryogenesis
  JOURNAL   Genes Dev 5 (4), 509-520 (1991)
   PUBMED   1672660
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC119204.7 and AC163327.2.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: ERR2844020.2189244.1,
                                           ERR2680379.383855.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN01164134, SAMN01164135
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-93                AC119204.7         6088-6180           c
            94-463              AC119204.7         3923-4292           c
            464-679             AC119204.7         60-275              c
            680-1070            AC163327.2         79571-79961
            1071-1135           AC163327.2         82210-82274
            1136-1389           AC163327.2         84508-84761
FEATURES             Location/Qualifiers
     source          1..1389
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="1"
                     /map="1 69.75 cM"
     gene            1..1389
                     /gene="Serpinc1"
                     /gene_synonym="At-3; At3; ATIII"
                     /note="serine (or cysteine) peptidase inhibitor, clade C
                     (antithrombin), member 1"
                     /db_xref="GeneID:11905"
                     /db_xref="MGI:MGI:88095"
     exon            1..93
                     /gene="Serpinc1"
                     /gene_synonym="At-3; At3; ATIII"
                     /inference="alignment:Splign:2.1.0"
     CDS             53..1312
                     /gene="Serpinc1"
                     /gene_synonym="At-3; At3; ATIII"
                     /note="isoform 4 precursor is encoded by transcript
                     variant 5; serpin peptidase inhibitor, clade C, member 1;
                     antithrombin-III; serpin C1; serine (or cysteine)
                     proteinase inhibitor, clade C (antithrombin), member 1;
                     anti-thrombin 3"
                     /codon_start=1
                     /product="antithrombin-III isoform 4 precursor"
                     /protein_id="NP_001406887.1"
                     /db_xref="GeneID:11905"
                     /db_xref="MGI:MGI:88095"
                     /translation="
MYSPGAGSGAAGERKLCLLSLLLIGALGCAICHGNPVDDICIAKPRDIPVNPLCIYRSPGKKATEEDGSEQKVPEATNRRVWELSKANSRFATNFYQHLADSKNDNDNIFLSPLSISTAFAMTKLGACNDTLKQLMEVFKFDTISEKTSDQIHFFFAKLNCRLYRKANKSSDLVSANRLFGDKSLTFNESYQDVSEVVYGAKLQPLDFKGLWKSKFSPENTRKEPFYKVDGQSCPVPMMYQEGKFKYRRVAEGTQVLELPFKGDDITMVLILPKPEKSLAKVEQELTPELLQEWLDELSETMLVVHMPRFRTEDGFSLKEQLQDMGLIDLFSPEKSQLPGIVAGGRDDLYVSDAFHKAFLEVNEEGSEAAASTSVVITGRSLNPNRVTFKANRPFLVLIREVALNTIIFMGRVANPCVN"
     sig_peptide     53..154
                     /gene="Serpinc1"
                     /gene_synonym="At-3; At3; ATIII"
                     /inference="COORDINATES: ab initio prediction:SignalP:6.0"
     misc_feature    263..1306
                     /gene="Serpinc1"
                     /gene_synonym="At-3; At3; ATIII"
                     /note="SERine Proteinase INhibitors (serpin) family;
                     Region: serpin; cl38926"
                     /db_xref="CDD:476815"
     misc_feature    order(1148..1180,1232..1234)
                     /gene="Serpinc1"
                     /gene_synonym="At-3; At3; ATIII"
                     /note="reactive center loop (RCL); other site"
                     /db_xref="CDD:381000"
     exon            94..463
                     /gene="Serpinc1"
                     /gene_synonym="At-3; At3; ATIII"
                     /inference="alignment:Splign:2.1.0"
     exon            464..679
                     /gene="Serpinc1"
                     /gene_synonym="At-3; At3; ATIII"
                     /inference="alignment:Splign:2.1.0"
     exon            680..1070
                     /gene="Serpinc1"
                     /gene_synonym="At-3; At3; ATIII"
                     /inference="alignment:Splign:2.1.0"
     exon            1071..1135
                     /gene="Serpinc1"
                     /gene_synonym="At-3; At3; ATIII"
                     /inference="alignment:Splign:2.1.0"
     exon            1136..1389
                     /gene="Serpinc1"
                     /gene_synonym="At-3; At3; ATIII"
                     /inference="alignment:Splign:2.1.0"
     regulatory      1368..1373
                     /regulatory_class="polyA_signal_sequence"
                     /gene="Serpinc1"
                     /gene_synonym="At-3; At3; ATIII"
                     /note="hexamer: AATAAA"
     polyA_site      1389
                     /gene="Serpinc1"
                     /gene_synonym="At-3; At3; ATIII"
                     /note="major polyA site"
ORIGIN      
agttttcggagtgatcgtctcagtcagcaccatctctgtaggagcatcggccatgtattcccctggggcaggaagtggggctgctggtgagaggaagctttgtctcctctctctgctcctcatcggtgccttgggctgtgctatctgtcacggaaaccctgtggacgacatctgcatagcgaagccccgagacatccccgtgaatcccttgtgcatttaccgctcccctgggaagaaggccaccgaggaggatggctcagagcagaaggttccagaagccaccaaccggcgggtctgggaactgtccaaggccaattcgcgatttgccactaacttctaccagcacctggcagactccaagaatgacaacgacaacattttcctgtcacccttgagcatctccactgcttttgctatgaccaagctgggtgcctgtaacgacactctcaagcagctgatggaggtttttaaatttgataccatctccgagaagacatccgaccagatccacttcttctttgccaaactgaactgccgactctatcgaaaagccaacaagtcctctgacttggtatcagccaaccgcctttttggagacaaatccctcaccttcaacgagagctatcaagatgttagtgaggttgtctatggagccaagctccagcccctggacttcaagggcctgtggaagtcaaagttcagccctgagaacacaaggaaggaaccgttctataaggtcgatgggcagtcatgcccagtgcctatgatgtaccaggaaggcaaattcaaataccggcgcgtggcagagggcacccaggtgctagagctgcccttcaagggggatgacatcaccatggtgctcatcctgcccaagcctgagaagagcctggccaaggtggagcaggagctcaccccagagctgctgcaggagtggctggatgagctgtcagagactatgcttgtggtccacatgccccgcttccgcaccgaggatggcttcagtctgaaggagcagctgcaagacatgggcctcattgatctcttcagccctgaaaagtcccaactcccagggatcgttgctggaggcagggacgacctctatgtctccgacgcattccacaaagcatttcttgaggtaaatgaggaaggcagtgaagcagcagcgagtacttctgtcgtgattactggccggtcactgaaccccaatagggtgaccttcaaggccaacaggcccttcctggttcttataagggaagttgcactgaacactattatattcatggggagagtggctaatccttgtgtgaactaaaatattcttaatctttgcaccttttcctactttggtgtttgtgaatagaagtaaaaataaatacgactgccacctca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]