ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-07-02 23:09:53, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NM_001419958 1389 bp mRNA linear ROD 05-MAY-2025
DEFINITION Mus musculus serine (or cysteine) peptidase inhibitor, clade C
(antithrombin), member 1 (Serpinc1), transcript variant 5, mRNA.
ACCESSION NM_001419958
VERSION NM_001419958.1
KEYWORDS RefSeq.
SOURCE Mus musculus (house mouse)
ORGANISM Mus musculus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE 1 (bases 1 to 1389)
AUTHORS Iwako,H., Tashiro,H., Okimoto,S., Yamaguchi,M., Abe,T., Kuroda,S.,
Kobayashi,T. and Ohdan,H.
TITLE Antithrombin Insufficiency Promotes Susceptibility to Liver
Tumorigenesis
JOURNAL J Surg Res 236, 198-208 (2019)
PUBMED 30694755
REMARK GeneRIF: Tumor size and the number of diethylnitrosamine and carbon
tetrachloride-induced liver tumors significantly increased in
antithrombin (AT)-insufficient mice compared with the wild-type
mice. AT insufficiency led to increased susceptibility to liver
tumorigenesis by increasing hepatic inflammation.
REFERENCE 2 (bases 1 to 1389)
AUTHORS Gould,T.W., Dominguez,B., de Winter,F., Yeo,G.W., Liu,P.,
Sundararaman,B., Stark,T., Vu,A., Degen,J.L., Lin,W. and Lee,K.F.
TITLE Glial cells maintain synapses by inhibiting an activity-dependent
retrograde protease signal
JOURNAL PLoS Genet 15 (3), e1007948 (2019)
PUBMED 30870413
REMARK GeneRIF: Trancriptomic analysis shows that expression of the
antithrombins serpin C1 and D1 is significantly reduced in Schwann
cell-deficient mice. In the absence of peripheral neuromuscular
activity, neurodegeneration is completely blocked, and expression
of prothrombin in muscle is markedly reduced.
Publication Status: Online-Only
REFERENCE 3 (bases 1 to 1389)
AUTHORS Heit,C., Jackson,B.C., McAndrews,M., Wright,M.W., Thompson,D.C.,
Silverman,G.A., Nebert,D.W. and Vasiliou,V.
TITLE Update of the human and mouse SERPIN gene superfamily
JOURNAL Hum Genomics 7 (1), 22 (2013)
PUBMED 24172014
REMARK Review article
Publication Status: Online-Only
REFERENCE 4 (bases 1 to 1389)
AUTHORS Safdar,H., Cheung,K.L., Salvatori,D., Versteeg,H.H., Laghmani
el,H., Wagenaar,G.T., Reitsma,P.H. and van Vlijmen,B.J.
TITLE Acute and severe coagulopathy in adult mice following silencing of
hepatic antithrombin and protein C production
JOURNAL Blood 121 (21), 4413-4416 (2013)
PUBMED 23550037
REMARK GeneRIF: RNA interference of Serpinc1 and/or Proc allows for
evaluation of the function of these genes in vivo and provides a
novel, controlled mouse model for spontaneous venous thrombosis.
REFERENCE 5 (bases 1 to 1389)
AUTHORS Naba,A., Clauser,K.R., Hoersch,S., Liu,H., Carr,S.A. and Hynes,R.O.
TITLE The matrisome: in silico definition and in vivo characterization by
proteomics of normal and tumor extracellular matrices
JOURNAL Mol Cell Proteomics 11 (4), M111.014647 (2012)
PUBMED 22159717
REFERENCE 6 (bases 1 to 1389)
AUTHORS Wu,J.K., Sheffield,W.P. and Blajchman,M.A.
TITLE Molecular cloning and cell-free expression of mouse antithrombin
III
JOURNAL Thromb Haemost 68 (3), 291-296 (1992)
PUBMED 1440494
REFERENCE 7 (bases 1 to 1389)
AUTHORS Serikawa,T., Montagutelli,X., Simon-Chazottes,D. and Guenet,J.L.
TITLE Polymorphisms revealed by PCR with single, short-sized, arbitrary
primers are reliable markers for mouse and rat gene mapping
JOURNAL Mamm Genome 3 (2), 65-72 (1992)
PUBMED 1617216
REFERENCE 8 (bases 1 to 1389)
AUTHORS Singh,G., Kaur,S., Stock,J.L., Jenkins,N.A., Gilbert,D.J.,
Copeland,N.G. and Potter,S.S.
TITLE Identification of 10 murine homeobox genes
JOURNAL Proc Natl Acad Sci U S A 88 (23), 10706-10710 (1991)
PUBMED 1683707
REFERENCE 9 (bases 1 to 1389)
AUTHORS Siracusa,L.D., Rosner,M.H., Vigano,M.A., Gilbert,D.J., Staudt,L.M.,
Copeland,N.G. and Jenkins,N.A.
TITLE Chromosomal location of the octamer transcription factors, Otf-1,
Otf-2, and Otf-3, defines multiple Otf-3-related sequences
dispersed in the mouse genome
JOURNAL Genomics 10 (2), 313-326 (1991)
PUBMED 1676977
REFERENCE 10 (bases 1 to 1389)
AUTHORS Allen,J.D., Lints,T., Jenkins,N.A., Copeland,N.G., Strasser,A.,
Harvey,R.P. and Adams,J.M.
TITLE Novel murine homeo box gene on chromosome 1 expressed in specific
hematopoietic lineages and during embryogenesis
JOURNAL Genes Dev 5 (4), 509-520 (1991)
PUBMED 1672660
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
AC119204.7 and AC163327.2.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: ERR2844020.2189244.1,
ERR2680379.383855.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
SAMN01164134, SAMN01164135
[ECO:0000348]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-93 AC119204.7 6088-6180 c
94-463 AC119204.7 3923-4292 c
464-679 AC119204.7 60-275 c
680-1070 AC163327.2 79571-79961
1071-1135 AC163327.2 82210-82274
1136-1389 AC163327.2 84508-84761
FEATURES Location/Qualifiers
source 1..1389
/organism="Mus musculus"
/mol_type="mRNA"
/strain="C57BL/6"
/db_xref="taxon:10090"
/chromosome="1"
/map="1 69.75 cM"
gene 1..1389
/gene="Serpinc1"
/gene_synonym="At-3; At3; ATIII"
/note="serine (or cysteine) peptidase inhibitor, clade C
(antithrombin), member 1"
/db_xref="GeneID:11905"
/db_xref="MGI:MGI:88095"
exon 1..93
/gene="Serpinc1"
/gene_synonym="At-3; At3; ATIII"
/inference="alignment:Splign:2.1.0"
CDS 53..1312
/gene="Serpinc1"
/gene_synonym="At-3; At3; ATIII"
/note="isoform 4 precursor is encoded by transcript
variant 5; serpin peptidase inhibitor, clade C, member 1;
antithrombin-III; serpin C1; serine (or cysteine)
proteinase inhibitor, clade C (antithrombin), member 1;
anti-thrombin 3"
/codon_start=1
/product="antithrombin-III isoform 4 precursor"
/protein_id="NP_001406887.1"
/db_xref="GeneID:11905"
/db_xref="MGI:MGI:88095"
/translation="
MYSPGAGSGAAGERKLCLLSLLLIGALGCAICHGNPVDDICIAKPRDIPVNPLCIYRSPGKKATEEDGSEQKVPEATNRRVWELSKANSRFATNFYQHLADSKNDNDNIFLSPLSISTAFAMTKLGACNDTLKQLMEVFKFDTISEKTSDQIHFFFAKLNCRLYRKANKSSDLVSANRLFGDKSLTFNESYQDVSEVVYGAKLQPLDFKGLWKSKFSPENTRKEPFYKVDGQSCPVPMMYQEGKFKYRRVAEGTQVLELPFKGDDITMVLILPKPEKSLAKVEQELTPELLQEWLDELSETMLVVHMPRFRTEDGFSLKEQLQDMGLIDLFSPEKSQLPGIVAGGRDDLYVSDAFHKAFLEVNEEGSEAAASTSVVITGRSLNPNRVTFKANRPFLVLIREVALNTIIFMGRVANPCVN"
sig_peptide 53..154
/gene="Serpinc1"
/gene_synonym="At-3; At3; ATIII"
/inference="COORDINATES: ab initio prediction:SignalP:6.0"
misc_feature 263..1306
/gene="Serpinc1"
/gene_synonym="At-3; At3; ATIII"
/note="SERine Proteinase INhibitors (serpin) family;
Region: serpin; cl38926"
/db_xref="CDD:476815"
misc_feature order(1148..1180,1232..1234)
/gene="Serpinc1"
/gene_synonym="At-3; At3; ATIII"
/note="reactive center loop (RCL); other site"
/db_xref="CDD:381000"
exon 94..463
/gene="Serpinc1"
/gene_synonym="At-3; At3; ATIII"
/inference="alignment:Splign:2.1.0"
exon 464..679
/gene="Serpinc1"
/gene_synonym="At-3; At3; ATIII"
/inference="alignment:Splign:2.1.0"
exon 680..1070
/gene="Serpinc1"
/gene_synonym="At-3; At3; ATIII"
/inference="alignment:Splign:2.1.0"
exon 1071..1135
/gene="Serpinc1"
/gene_synonym="At-3; At3; ATIII"
/inference="alignment:Splign:2.1.0"
exon 1136..1389
/gene="Serpinc1"
/gene_synonym="At-3; At3; ATIII"
/inference="alignment:Splign:2.1.0"
regulatory 1368..1373
/regulatory_class="polyA_signal_sequence"
/gene="Serpinc1"
/gene_synonym="At-3; At3; ATIII"
/note="hexamer: AATAAA"
polyA_site 1389
/gene="Serpinc1"
/gene_synonym="At-3; At3; ATIII"
/note="major polyA site"
ORIGIN
agttttcggagtgatcgtctcagtcagcaccatctctgtaggagcatcggccatgtattcccctggggcaggaagtggggctgctggtgagaggaagctttgtctcctctctctgctcctcatcggtgccttgggctgtgctatctgtcacggaaaccctgtggacgacatctgcatagcgaagccccgagacatccccgtgaatcccttgtgcatttaccgctcccctgggaagaaggccaccgaggaggatggctcagagcagaaggttccagaagccaccaaccggcgggtctgggaactgtccaaggccaattcgcgatttgccactaacttctaccagcacctggcagactccaagaatgacaacgacaacattttcctgtcacccttgagcatctccactgcttttgctatgaccaagctgggtgcctgtaacgacactctcaagcagctgatggaggtttttaaatttgataccatctccgagaagacatccgaccagatccacttcttctttgccaaactgaactgccgactctatcgaaaagccaacaagtcctctgacttggtatcagccaaccgcctttttggagacaaatccctcaccttcaacgagagctatcaagatgttagtgaggttgtctatggagccaagctccagcccctggacttcaagggcctgtggaagtcaaagttcagccctgagaacacaaggaaggaaccgttctataaggtcgatgggcagtcatgcccagtgcctatgatgtaccaggaaggcaaattcaaataccggcgcgtggcagagggcacccaggtgctagagctgcccttcaagggggatgacatcaccatggtgctcatcctgcccaagcctgagaagagcctggccaaggtggagcaggagctcaccccagagctgctgcaggagtggctggatgagctgtcagagactatgcttgtggtccacatgccccgcttccgcaccgaggatggcttcagtctgaaggagcagctgcaagacatgggcctcattgatctcttcagccctgaaaagtcccaactcccagggatcgttgctggaggcagggacgacctctatgtctccgacgcattccacaaagcatttcttgaggtaaatgaggaaggcagtgaagcagcagcgagtacttctgtcgtgattactggccggtcactgaaccccaatagggtgaccttcaaggccaacaggcccttcctggttcttataagggaagttgcactgaacactattatattcatggggagagtggctaatccttgtgtgaactaaaatattcttaatctttgcaccttttcctactttggtgtttgtgaatagaagtaaaaataaatacgactgccacctca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]