GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-01-31 02:26:43, GGRNA.v2 : RefSeq release 227 (Nov, 2024)

LOCUS       NM_001417226             893 bp    mRNA    linear   ROD 01-JUL-2024
DEFINITION  Mus musculus ribosomal protein S5 (Rps5), transcript variant 1,
            mRNA.
ACCESSION   NM_001417226
VERSION     NM_001417226.1
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 893)
  AUTHORS   Yin,D. and Shen,G.
  TITLE     Exosomes from adipose-derived stem cells regulate macrophage
            polarization and accelerate diabetic wound healing via the
            circ-Rps5/miR-124-3p axis
  JOURNAL   Immun Inflamm Dis 12 (6), e1274 (2024)
   PUBMED   38888351
  REMARK    GeneRIF: Exosomes from adipose-derived stem cells regulate
            macrophage polarization and accelerate diabetic wound healing via
            the circ-Rps5/miR-124-3p axis.
REFERENCE   2  (bases 1 to 893)
  AUTHORS   Li,H., Huo,Y., He,X., Yao,L., Zhang,H., Cui,Y., Xiao,H., Xie,W.,
            Zhang,D., Wang,Y., Zhang,S., Tu,H., Cheng,Y., Guo,Y., Cao,X.,
            Zhu,Y., Jiang,T., Guo,X., Qin,Y. and Sha,J.
  TITLE     A male germ-cell-specific ribosome controls male fertility
  JOURNAL   Nature 612 (7941), 725-731 (2022)
   PUBMED   36517592
REFERENCE   3  (bases 1 to 893)
  AUTHORS   Harnett,D., Ambrozkiewicz,M.C., Zinnall,U., Rusanova,A.,
            Borisova,E., Drescher,A.N., Couce-Iglesias,M., Villamil,G.,
            Dannenberg,R., Imami,K., Munster-Wandowski,A., Fauler,B.,
            Mielke,T., Selbach,M., Landthaler,M., Spahn,C.M.T., Tarabykin,V.,
            Ohler,U. and Kraushar,M.L.
  TITLE     A critical period of translational control during brain development
            at codon resolution
  JOURNAL   Nat Struct Mol Biol 29 (12), 1277-1290 (2022)
   PUBMED   36482253
REFERENCE   4  (bases 1 to 893)
  AUTHORS   Zhang,M., Chen,D., Xia,J., Han,W., Cui,X., Neuenkirchen,N.,
            Hermes,G., Sestan,N. and Lin,H.
  TITLE     Post-transcriptional regulation of mouse neurogenesis by Pumilio
            proteins
  JOURNAL   Genes Dev 31 (13), 1354-1369 (2017)
   PUBMED   28794184
REFERENCE   5  (bases 1 to 893)
  AUTHORS   Vizirianakis,I.S., Papachristou,E.T., Andreadis,P., Zopounidou,E.,
            Matragkou,C.N. and Tsiftsoglou,A.S.
  TITLE     Genetic manipulation of RPS5 gene expression modulates the
            initiation of commitment of MEL cells to erythroid maturation:
            Implications in understanding ribosomopathies
  JOURNAL   Int J Oncol 47 (1), 303-314 (2015)
   PUBMED   25998414
  REMARK    GeneRIF: Findings support the concept that genetic manipulation of
            RPS5 gene expression level (up- and/or downregulation) critically
            affects the potential of murine erythroleukemia cells to fully
            complete their erythroid maturation program in vitro.
REFERENCE   6  (bases 1 to 893)
  AUTHORS   Stryke,D., Kawamoto,M., Huang,C.C., Johns,S.J., King,L.A.,
            Harper,C.A., Meng,E.C., Lee,R.E., Yee,A., L'Italien,L.,
            Chuang,P.T., Young,S.G., Skarnes,W.C., Babbitt,P.C. and Ferrin,T.E.
  TITLE     BayGenomics: a resource of insertional mutations in mouse embryonic
            stem cells
  JOURNAL   Nucleic Acids Res 31 (1), 278-281 (2003)
   PUBMED   12520002
REFERENCE   7  (bases 1 to 893)
  AUTHORS   Reymond,A., Marigo,V., Yaylaoglu,M.B., Leoni,A., Ucla,C.,
            Scamuffa,N., Caccioppoli,C., Dermitzakis,E.T., Lyle,R., Banfi,S.,
            Eichele,G., Antonarakis,S.E. and Ballabio,A.
  TITLE     Human chromosome 21 gene expression atlas in the mouse
  JOURNAL   Nature 420 (6915), 582-586 (2002)
   PUBMED   12466854
REFERENCE   8  (bases 1 to 893)
  AUTHORS   Pfisterer,P., Ehlermann,J., Hegen,M. and Schorle,H.
  TITLE     A subtractive gene expression screen suggests a role of
            transcription factor AP-2 alpha in control of proliferation and
            differentiation
  JOURNAL   J Biol Chem 277 (8), 6637-6644 (2002)
   PUBMED   11741941
REFERENCE   9  (bases 1 to 893)
  AUTHORS   Vizirianakis,I.S., Pappas,I.S., Gougoumas,D. and Tsiftsoglou,A.S.
  TITLE     Expression of ribosomal protein S5 cloned gene during
            differentiation and apoptosis in murine erythroleukemia (MEL) cells
  JOURNAL   Oncol Res 11 (9), 409-419 (1999)
   PUBMED   10821535
REFERENCE   10 (bases 1 to 893)
  AUTHORS   Vanegas,N., Castaneda,V., Santamaria,D., Hernandez,P.,
            Schvartzman,J.B. and Krimer,D.B.
  TITLE     Cloning, sequencing and expression in MEL cells of a cDNA encoding
            the mouse ribosomal protein S5
  JOURNAL   Biochim Biophys Acta 1357 (1), 1-4 (1997)
   PUBMED   9202169
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC107704.8.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR13422601.1320517.1,
                                           SRR7652917.391024.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN00849374, SAMN00849375
                                           [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-231               AC107704.8         141288-141518
            232-340             AC107704.8         141943-142051
            341-550             AC107704.8         144362-144571
            551-679             AC107704.8         144707-144835
            680-778             AC107704.8         145366-145464
            779-893             AC107704.8         145542-145656
FEATURES             Location/Qualifiers
     source          1..893
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="7"
                     /map="7 7.69 cM"
     gene            1..893
                     /gene="Rps5"
                     /note="ribosomal protein S5"
                     /db_xref="GeneID:20103"
                     /db_xref="MGI:MGI:1097682"
     exon            1..231
                     /gene="Rps5"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    209..211
                     /gene="Rps5"
                     /note="upstream in-frame stop codon"
     exon            232..340
                     /gene="Rps5"
                     /inference="alignment:Splign:2.1.0"
     CDS             233..847
                     /gene="Rps5"
                     /note="40S ribosomal protein S5; S5 ribosomal protein"
                     /codon_start=1
                     /product="small ribosomal subunit protein uS7"
                     /protein_id="NP_001404155.1"
                     /db_xref="GeneID:20103"
                     /db_xref="MGI:MGI:1097682"
                     /translation="
MTEWEAATPAVAETPDIKLFGKWSTDDVQINDISLQDYIAVKEKYAKYLPHSAGRYAAKRFRKAQCPIVERLTNSMMMHGRNNGKKLMTVRIVKHAFEIIHLLTGENPLQVLVNAIINSGPREDSTRIGRAGTVRRQAVDVSPLRRVNQAIWLLCTGAREAAFRNIKTIAECLADELINAAKGSSNSYAIKKKDELERVAKSNR"
     misc_feature    233..235
                     /gene="Rps5"
                     /note="N-acetylmethionine.
                     /evidence=ECO:0000250|UniProtKB:P46782; propagated from
                     UniProtKB/Swiss-Prot (P97461.4); acetylation site"
     misc_feature    236..238
                     /gene="Rps5"
                     /note="N-acetylthreonine, in 40S ribosomal protein S5,
                     N-terminally processed.
                     /evidence=ECO:0000250|UniProtKB:P46782; propagated from
                     UniProtKB/Swiss-Prot (P97461.4); acetylation site"
     misc_feature    272..274
                     /gene="Rps5"
                     /note="Phosphothreonine.
                     /evidence=ECO:0000250|UniProtKB:P46782; propagated from
                     UniProtKB/Swiss-Prot (P97461.4); phosphorylation site"
     misc_feature    284..844
                     /gene="Rps5"
                     /note="Eukaryota homolog of Ribosomal Protein S7; Region:
                     uS7_Eukaryote; cd14867"
                     /db_xref="CDD:271246"
     misc_feature    order(284..286,371..379,383..394,491..493,503..505)
                     /gene="Rps5"
                     /note="S9 interface [polypeptide binding]; other site"
                     /db_xref="CDD:271246"
     misc_feature    371..373
                     /gene="Rps5"
                     /note="N6-acetyllysine, alternate.
                     /evidence=ECO:0007744|PubMed:23806337; propagated from
                     UniProtKB/Swiss-Prot (P97461.4); acetylation site"
     misc_feature    order(383..385,389..391,401..412,419..421,443..445,
                     452..454,458..472,482..496,503..505,623..631,635..637,
                     665..667,686..688,707..709,716..718,734..739)
                     /gene="Rps5"
                     /note="rRNA binding site [nucleotide binding]; other site"
                     /db_xref="CDD:271246"
     misc_feature    order(515..517,524..529,536..538,734..736,740..745)
                     /gene="Rps5"
                     /note="S25 interface [polypeptide binding]; other site"
                     /db_xref="CDD:271246"
     misc_feature    order(620..622,629..631,635..637,842..844)
                     /gene="Rps5"
                     /note="S11 interface [polypeptide binding]; other site"
                     /db_xref="CDD:271246"
     misc_feature    656..658
                     /gene="Rps5"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P46782; propagated from
                     UniProtKB/Swiss-Prot (P97461.4); phosphorylation site"
     exon            341..550
                     /gene="Rps5"
                     /inference="alignment:Splign:2.1.0"
     exon            551..679
                     /gene="Rps5"
                     /inference="alignment:Splign:2.1.0"
     exon            680..778
                     /gene="Rps5"
                     /inference="alignment:Splign:2.1.0"
     exon            779..893
                     /gene="Rps5"
                     /inference="alignment:Splign:2.1.0"
     regulatory      865..870
                     /regulatory_class="polyA_signal_sequence"
                     /gene="Rps5"
                     /note="hexamer: AATAAA"
     polyA_site      893
                     /gene="Rps5"
                     /note="major polyA site"
ORIGIN      
ctcttcctgtctgtatcagggcggcgcgtggtccacgccgagcgactgagaagcccagtctgcgccctcaggtgaggctgcggagggacacggagttcagaagaggtgaccatgagtgttctaaggcacatctggggggccggaggccgaacctgaagcctgggcgtgaccgcttggatctcaccgtttctctgcgaaaaagggtgcctagggaaactcggcacgggccgagatgactgagtgggaagcagccacaccagcggtggcagagacccctgacatcaagctctttgggaaatggagcactgatgacgtgcagatcaacgatatttctctgcaggattacattgctgtgaaggagaagtatgccaagtacctgccccacagtgccggacggtatgctgccaagcgcttccgcaaagcacaatgtcccatcgtggagcgccttactaactccatgatgatgcatggtcgtaacaacggcaagaagctcatgactgtgcgaattgtcaagcatgcctttgagatcatccacctgctcactggtgagaaccctctgcaggtcctggtgaatgctatcatcaacagtggcccccgagaagactcaacacgcattgggcgggccggtacagtgagacgacaggctgtggatgtgtccccactgcgtcgagtgaatcaggccatctggctgctgtgcacaggggctcgtgaggctgctttccggaacatcaagaccatcgccgagtgccttgcagatgagctcattaatgctgccaagggctcctccaattcctatgccatcaagaagaaagatgaactggagcgtgtggccaagtctaaccgctgatttcccagctgctgcctaataaactgtgtcctttggaacaactata
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]