LOCUS       NM_001308647            5338 bp    mRNA    linear   ROD 29-OCT-2024
DEFINITION  Mus musculus aquaporin 4 (Aqp4), transcript variant 2, mRNA.
ACCESSION   NM_001308647 XM_006525540
VERSION     NM_001308647.2
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 5338)
  AUTHORS   Abbrescia,P., Signorile,G., Valente,O., Palazzo,C., Cibelli,A.,
            Nicchia,G.P. and Frigeri,A.
  TITLE     Crucial role of Aquaporin-4 extended isoform in brain water
            Homeostasis and Amyloid-beta clearance: implications for Edema and
            neurodegenerative diseases
  JOURNAL   Acta Neuropathol Commun 12 (1), 159 (2024)
   PUBMED   39385254
  REMARK    GeneRIF: Crucial role of Aquaporin-4 extended isoform in brain
            water Homeostasis and Amyloid-beta clearance: implications for
            Edema and neurodegenerative diseases.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 5338)
  AUTHORS   Xing,X. and Zhang,S.
  TITLE     Neuroprotective Role of AQP4 Knockdown in Astrocytes After
            Oxygen-Glucose Deprivation
  JOURNAL   Brain Behav 14 (10), e70107 (2024)
   PUBMED   39444081
  REMARK    GeneRIF: Neuroprotective Role of AQP4 Knockdown in Astrocytes After
            Oxygen-Glucose Deprivation.
REFERENCE   3  (bases 1 to 5338)
  AUTHORS   Loughran,G., Chou,M.Y., Ivanov,I.P., Jungreis,I., Kellis,M.,
            Kiran,A.M., Baranov,P.V. and Atkins,J.F.
  TITLE     Evidence of efficient stop codon readthrough in four mammalian
            genes
  JOURNAL   Nucleic Acids Res 42 (14), 8928-8938 (2014)
   PUBMED   25013167
REFERENCE   4  (bases 1 to 5338)
  AUTHORS   Badaut,J., Ashwal,S., Adami,A., Tone,B., Recker,R., Spagnoli,D.,
            Ternon,B. and Obenaus,A.
  TITLE     Brain water mobility decreases after astrocytic aquaporin-4
            inhibition using RNA interference
  JOURNAL   J Cereb Blood Flow Metab 31 (3), 819-831 (2011)
   PUBMED   20877385
  REMARK    GeneRIF: results demonstrate that apparent diffusion coefficient
            values in normal brain are modulated by astrocytic AQP4; suggest
            imaging changes seen in acute neurologic disorders such as stroke
            and trauma are in part due to changes in tissue AQP4 levels
REFERENCE   5  (bases 1 to 5338)
  AUTHORS   Beier,H. and Grimm,M.
  TITLE     Misreading of termination codons in eukaryotes by natural nonsense
            suppressor tRNAs
  JOURNAL   Nucleic Acids Res 29 (23), 4767-4782 (2001)
   PUBMED   11726686
  REMARK    Review article
REFERENCE   6  (bases 1 to 5338)
  AUTHORS   Zelenin,S., Gunnarson,E., Alikina,T., Bondar,A. and Aperia,A.
  TITLE     Identification of a new form of AQP4 mRNA that is developmentally
            expressed in mouse brain
  JOURNAL   Pediatr Res 48 (3), 335-339 (2000)
   PUBMED   10960499
REFERENCE   7  (bases 1 to 5338)
  AUTHORS   Ishida,N., Hirai,S.I. and Mita,S.
  TITLE     Immunolocalization of aquaporin homologs in mouse lacrimal glands
  JOURNAL   Biochem Biophys Res Commun 238 (3), 891-895 (1997)
   PUBMED   9325187
REFERENCE   8  (bases 1 to 5338)
  AUTHORS   Ma,T., Yang,B., Gillespie,A., Carlson,E.J., Epstein,C.J. and
            Verkman,A.S.
  TITLE     Generation and phenotype of a transgenic knockout mouse lacking the
            mercurial-insensitive water channel aquaporin-4
  JOURNAL   J Clin Invest 100 (5), 957-962 (1997)
   PUBMED   9276712
REFERENCE   9  (bases 1 to 5338)
  AUTHORS   Turtzo,L.C., Lee,M.D., Lu,M., Smith,B.L., Copeland,N.G.,
            Gilbert,D.J., Jenkins,N.A. and Agre,P.
  TITLE     Cloning and chromosomal localization of mouse aquaporin 4:
            exclusion of a candidate mutant phenotype, ataxia
  JOURNAL   Genomics 41 (2), 267-270 (1997)
   PUBMED   9143504
REFERENCE   10 (bases 1 to 5338)
  AUTHORS   Ma,T., Yang,B. and Verkman,A.S.
  TITLE     Gene structure, cDNA cloning, and expression of a mouse
            mercurial-insensitive water channel
  JOURNAL   Genomics 33 (3), 382-388 (1996)
   PUBMED   8660998
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AF469169.1, U88623.1,
            AK045357.1, BX633380.1, AK079614.1, BB750519.1 and AC133525.2.
            
            On Dec 7, 2015 this sequence version replaced NM_001308647.1.
            
            Summary: This gene encodes a member of the aquaporin family of
            intrinsic membrane proteins that function as water-selective
            channels in the plasma membranes of many cells. This protein is the
            predominant aquaporin found in brain and has an important role in
            brain water homeostasis. Alternatively spliced transcript variants
            encoding different isoforms have been described for this gene. A
            recent study provided evidence for translational readthrough in
            this gene and expression of an additional C-terminally extended
            isoform via the use of an alternative in-frame translation
            termination codon. [provided by RefSeq, Dec 2015].
            
            Transcript Variant: This variant (2, also known as AQP4.M23X or
            mMIWC1) contains an alternate 5' terminal exon, which causes
            translation initiation from an in-frame, downstream start codon,
            compared to variant 1. The resulting isoform (M23, also known as
            M23X) has a shorter N-terminus compared to isoform 1. Variants 2-8
            encode the same isoform.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AF469169.1, SRR1660815.231890.1
                                           [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN01164131 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-443               AF469169.1         1-443
            444-1356            U88623.1           189-1101
            1357-2206           AK045357.1         752-1601
            2207-2207           BX633380.1         202-202             c
            2208-4079           AK045357.1         1602-3473
            4080-5236           AK079614.1         167-1323
            5237-5332           BB750519.1         317-412
            5333-5338           AC133525.2         180919-180924       c
FEATURES             Location/Qualifiers
     source          1..5338
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /db_xref="taxon:10090"
                     /chromosome="18"
                     /map="18 8.74 cM"
     gene            1..5338
                     /gene="Aqp4"
                     /gene_synonym="WCH4"
                     /note="aquaporin 4"
                     /db_xref="GeneID:11829"
                     /db_xref="MGI:MGI:107387"
     exon            1..341
                     /gene="Aqp4"
                     /gene_synonym="WCH4"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    136..138
                     /gene="Aqp4"
                     /gene_synonym="WCH4"
                     /note="upstream in-frame stop codon"
     exon            342..756
                     /gene="Aqp4"
                     /gene_synonym="WCH4"
                     /inference="alignment:Splign:2.1.0"
     CDS             376..1281
                     /gene="Aqp4"
                     /gene_synonym="WCH4"
                     /note="isoform M23 is encoded by transcript variant 2;
                     mercurial-insensitive water channel"
                     /codon_start=1
                     /product="aquaporin-4 isoform M23"
                     /protein_id="NP_001295576.1"
                     /db_xref="CCDS:CCDS89196.1"
                     /db_xref="GeneID:11829"
                     /db_xref="MGI:MGI:107387"
                     /translation="

MVAFKGVWTQAFWKAVSAEFLATLIFVLLGVGSTINWGGSENPLPVDMVLISLCFGLSIATMVQCFGHISGGHINPAVTVAMVCTRKISIAKSVFYIIAQCLGAIIGAGILYLVTPPSVVGGLGVTTVHGNLTAGHGLLVELIITFQLVFTIFASCDSKRTDVTGSIALAIGFSVAIGHLFAINYTGASMNPARSFGPAVIMGNWANHWIYWVGPIMGAVLAGALYEYVFCPDVELKRRLKEAFSKAAQQTKGSYMEVEDNRSQVETEDLILKPGVVHVIDIDRGEEKKGKDSSGEVLSSV"

     misc_feature    400..1053
                     /gene="Aqp4"
                     /gene_synonym="WCH4"
                     /note="Major intrinsic protein; Region: MIP; pfam00230"
                     /db_xref="CDD:395174"
     misc_feature    order(538..540,592..600,934..939,946..948,955..957)
                     /gene="Aqp4"
                     /gene_synonym="WCH4"
                     /note="amphipathic channel [active]"
                     /db_xref="CDD:238204"
     misc_feature    order(598..606,946..954)
                     /gene="Aqp4"
                     /gene_synonym="WCH4"
                     /note="Asn-Pro-Ala signature motifs; other site"
                     /db_xref="CDD:238204"
     exon            757..921
                     /gene="Aqp4"
                     /gene_synonym="WCH4"
                     /inference="alignment:Splign:2.1.0"
     exon            922..1002
                     /gene="Aqp4"
                     /gene_synonym="WCH4"
                     /inference="alignment:Splign:2.1.0"
     exon            1003..5338
                     /gene="Aqp4"
                     /gene_synonym="WCH4"
                     /inference="alignment:Splign:2.1.0"
     regulatory      5218..5223
                     /regulatory_class="polyA_signal_sequence"
                     /gene="Aqp4"
                     /gene_synonym="WCH4"
                     /note="hexamer: ATTAAA"
     polyA_site      5236
                     /gene="Aqp4"
                     /gene_synonym="WCH4"
                     /note="major polyA site"
ORIGIN      

tctatttatggttcacgggtttggatgctttgtttttttctttttaatttctctgatgaaaaaatgaggttcaaagagcaactgagtttcttgattaggtctctggagagggggacaggtgtgtgaatgagcaggtgacaaagggtgctggagggaggctggccttttccaggaccgcctcccctgggtgctctgctattgagcagggactgtttcctacccaccctgctccctgcacttcctgcttggtccccttctctttcctctctctgggcctcagaagacagcacctgtaatagcactttgcccctctgccacctggctacaaccctggactgctgtaagtgtggacattcctgcagtagagagagcatcatggtggctttcaaaggagtctggactcaggctttctggaaggcagtctcagcagaatttctggccacgcttatctttgttttgctcggtgtgggatccaccataaactggggtggctcagaaaaccccttacctgtggacatggtcctcatctccctttgctttggactcagcattgctaccatggtgcagtgctttggccacatcagtggtggccacatcaatcccgctgtgactgtagccatggtgtgcacacgaaagatcagcatcgctaagtccgtcttctacatcattgcacagtgcctgggggccatcattggagccggcatcctctacctggtcacacctcccagtgtggttggaggattgggagtcaccacggttcatggaaacctcaccgctggccatgggctcctggtggagttaataatcactttccagttggtgttcactatttttgccagctgtgattccaaacgaactgatgttactggttcaatagctttagcaattggattttccgttgcaattggacatttgtttgcaatcaattatactggagccagcatgaatccagctcgatcttttggacccgcagttatcatgggaaactgggcaaaccactggatatattgggttggaccaatcatgggcgctgtgctggcaggtgccctttatgagtatgtcttctgtcctgatgtggagctcaaacgtcgccttaaggaagccttcagcaaagccgcgcagcagacaaaagggagctacatggaggtggaggacaaccggagccaagtggagacggaagacttgatcctgaagcccggagtggtgcatgtgattgacattgaccgtggagaagagaagaaggggaaagactcttcgggagaggtattgtcttccgtatgactagaggacagcactgaaggcagaagagactccctagacctggcctcagatttcctgccacccattaaggaaacagatttgttataaattagacacttgcgggtttcttgcttcacaccttgttacacagtttaaataacacatattttactattatcaatggggggggtgagaaaaagcctataatggatataaaattttaaaacagaaatctttttgaatgtatccccaaagcaactatgcaactagtgtattggcttccctttcattaataactgaaattatgaaccaagatctggtcaagttttgccgtgcagagcatatggacacctctgtgaggaagctggcattgtccatcgtcttgactattgacttcattggattgatttaaaaatgacaaaatgcagtatgtcacagaatcatgtgcattcaggagaagacatgcagtaacttcttccacgagctattccttatttataaactacctcggagggggaaaacattagcaagggccattgctaatacatcatttgtatttatatatctgactgtcagaacctaactctaattcactataatcctctccccctcagaatccaagaacccatagggctaaaagtaaaaaaaaaataggaaaaaatattaatttctgtccatgtgttagttccatcaaatgaaagctatacatgggacacccattgaggttcaggacagccagacttgggagtctggtgggaggtggaacaaggtgtgctactgccttgcatccatcacacggagagggaaacctctgttatcaaatgattggtctgttttcagtgcacactcttaaatgtaccacaaaccattaaccacctaagcttttaactatttcactgactttttaaagcttatttgcaaaactggggaatttgtttgccattttgatccctaaatactagcagagacattttagaccagaacttgactagtcgagtcctgacttttagttggtgtctaaatcctgcttactctagctggtataaaccagtcctgccccatcttagctgctgatgctgttttgattcccacgatatgcatcgacaatcggcattgtgagtgtaattatacccatttgtgtgaattaaaatatatgcagacaaggtgcaacgtggttgccaaataaaggggtgagcacacagcctctgtgcaaagctcctagttaccccatctgcacatagcttaccatcatgcttttaaggtatttacctcctgcttggtttatttgttaaaaccatttatttctcccatactgctttgccttccgcccatcgaatgctctgtggaaaccccagtttctatgatcataacagtctagcatagcatttatcttagacaatgtgctgcaaatgtcgatttcagtaaacaaaagttagtagtggaagagagaagagccatttcttcaaggactagcttgtaaatagctggtaatggagggctttcttctcccaagcacaattccaactgtgtgtgacttcttattgttaatggcagttttgtgtctgtggcagcgagataatggaccactattaaacctgattctcttcggtgctaggaaactgatgtgtgagttcccagaaaggcacgagggcagcatatgcctctcggtgccatggtcatgttctgaggcagatgctgggagcatgggccacatttcagggctttgaatatactacaccagagacataagcttcctctctgagcagatcacgcagaaccagggcatagacctcccaggggaggtttctgccgattctttcaaatgttttcacaatataccacgcagacttaagatcagagcgcttcagttcggaaggtgatatcaaccatcaacaaatatgtcgggtcaaaaataaatttacttaacaaggaatagttaagcacatttctgattactctttcaaaatcctggcctgtgattatttttattatgctagacagcttgcttcgtttgtgctcactttaacagtcatttccagtgacagcattcagtatggtacaaactgaaaaacagggaatcatagcttagtgatttgtttgctagcagctggcagagtgccaggcacacagtaggcaatcaaaacaagcatgttgtttgaatatatatacatatatacatatatacatatatacatatatacatatatgtgtatatatgattcttatttgggatttaaaataccaataatctcctctaatttttaattttgcccaatatttagtgaaaacataatttttagtgtcatcaataaaagcaacatggacttggaaacaaagagcatatttttacattctactgtttgaaggcagagagtgactacttcacactcttcgtctttgcaatatgtcttgcatttcactcacggctctgccagtaaaaaatgtaatgaaattgtccctttctaatgacatcgatgcagcaggggtctattgccttgtggatgacaccaaattatacaacatattaggagatcggggattttccctttaatcccttcttattaatgaagtgcatagtgccgttcccaagagacagctactgacagatacaccgcacagagatcagagaggaaaaatcaggaagacataaaagatttatacgagccatgaaacaatgccaactgtctgttccctcaggaggagaacacagacacaccacaaatttcaaggtggtccatacactggaaatgtacatacatagtctgtcaaaggagaacagaaggaaatcttttttttttaattttgagcattttttttttcaaatcagagactctgatttttaaatgtgtgtttccattttcttccaaatgttctacccttttatactacaagaaactgtttcctgtagcctaagtcactggtaattttacaacttgttcctgtgatttgccactatcatgagtcctcttccgttcgatcttcagaggggtgtcccaccacagctcggacactgctggccacagctgctccctgatgaagatttcataaggagttggtagtctctgggaaatgggctgatatattagaggtcaatttcaaaaactgcaacatttctcctaggagaatccaggcaatgtgtgcactgctctaaccccactgagaaccctgacatctcaaaatgaagggactaattaaaatggtggcattggtccttgcctggcctttgttgtgtgatgttgacaccttcctcatagatcagaaatctcacagagacactgcctctgtgacaattgaagccagagagccaaacagacaatcttacaaaagccatgagacgctctaatcactaaactacaggatacgtgaacttggaattgtgcaagcatggcctctacttgaaagtggactataacaaaagaaactttatttacctcaacttttctgagttcatgtccaggtgtcaatacttttcagcacaccttaactaacacaaatatttgaaatccaaaattctcagaaagaaatgttaagacgcttaacttcaaaaatcaaaaattgcggatattcacttttggcacataacttccctgaaaacacacaccaaacaaatattaaacaacacatacagtgaacactacatttaagagcagttatattgttactgttttaagtcaaaattcaagagcttaaaaaatgcccaacatatatattccattgcaatgtattcttagattgttttcaggcttgatcaaataaacatggaatttgtggaaatatattttaaaaatctatttatcattttctctcccaattcacaattaacttgcgacttatgaggaactaaaaaaataaaatgaatgcctggttatattcacatttattaactaaatattattccaactttagagttaatgttaaatggatttgaactgtaatggctaatatttggaaaaatctattaaaagtattagcagtgtggctgggttctgtttcttgtgttatatgtcatactattagtatcatacaattaagtcttcaaatgttttaaaaataaaccatatatttgatggtgtttaag

//