GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-04-20 02:39:25, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       NM_001168295            2042 bp    mRNA    linear   ROD 03-JUN-2024
DEFINITION  Mus musculus serine (or cysteine) peptidase inhibitor, clade A,
            member 3F (Serpina3f), transcript variant 3, mRNA.
ACCESSION   NM_001168295
VERSION     NM_001168295.1
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 2042)
  AUTHORS   Kidoya,H., Naito,H., Muramatsu,F., Yamakawa,D., Jia,W., Ikawa,M.,
            Sonobe,T., Tsuchimochi,H., Shirai,M., Adams,R.H., Fukamizu,A. and
            Takakura,N.
  TITLE     APJ Regulates Parallel Alignment of Arteries and Veins in the Skin
  JOURNAL   Dev Cell 33 (3), 247-259 (2015)
   PUBMED   25920569
REFERENCE   2  (bases 1 to 2042)
  AUTHORS   Heit,C., Jackson,B.C., McAndrews,M., Wright,M.W., Thompson,D.C.,
            Silverman,G.A., Nebert,D.W. and Vasiliou,V.
  TITLE     Update of the human and mouse SERPIN gene superfamily
  JOURNAL   Hum Genomics 7 (1), 22 (2013)
   PUBMED   24172014
  REMARK    Review article
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 2042)
  AUTHORS   Archambaud,C., Nahori,M.A., Soubigou,G., Becavin,C., Laval,L.,
            Lechat,P., Smokvina,T., Langella,P., Lecuit,M. and Cossart,P.
  TITLE     Impact of lactobacilli on orally acquired listeriosis
  JOURNAL   Proc Natl Acad Sci U S A 109 (41), 16684-16689 (2012)
   PUBMED   23012479
REFERENCE   4  (bases 1 to 2042)
  AUTHORS   Ghesquiere,B., Van Damme,J., Martens,L., Vandekerckhove,J. and
            Gevaert,K.
  TITLE     Proteome-wide characterization of N-glycosylation events by
            diagonal chromatography
  JOURNAL   J Proteome Res 5 (9), 2438-2447 (2006)
   PUBMED   16944957
REFERENCE   5  (bases 1 to 2042)
  AUTHORS   Winkler,I.G., Hendy,J., Coughlin,P., Horvath,A. and Levesque,J.P.
  TITLE     Serine protease inhibitors serpina1 and serpina3 are down-regulated
            in bone marrow during hematopoietic progenitor mobilization
  JOURNAL   J Exp Med 201 (7), 1077-1088 (2005)
   PUBMED   15795238
REFERENCE   6  (bases 1 to 2042)
  AUTHORS   Horvath,A.J., Forsyth,S.L. and Coughlin,P.B.
  TITLE     Expression patterns of murine antichymotrypsin-like genes reflect
            evolutionary divergence at the Serpina3 locus
  JOURNAL   J Mol Evol 59 (4), 488-497 (2004)
   PUBMED   15638460
REFERENCE   7  (bases 1 to 2042)
  AUTHORS   Forsyth,S., Horvath,A. and Coughlin,P.
  TITLE     A review and comparison of the murine alpha1-antitrypsin and
            alpha1-antichymotrypsin multigene clusters with the human clade A
            serpins
  JOURNAL   Genomics 81 (3), 336-345 (2003)
   PUBMED   12659817
  REMARK    Review article
REFERENCE   8  (bases 1 to 2042)
  AUTHORS   Inglis,J.D. and Hill,R.E.
  TITLE     The murine Spi-2 proteinase inhibitor locus: a multigene family
            with a hypervariable reactive site domain
  JOURNAL   EMBO J 10 (2), 255-261 (1991)
   PUBMED   1991447
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AK150157.1, BC139132.1, AK138954.1 and AC142112.3.
            
            Transcript Variant: This variant (3) differs in the 5' UTR compared
            to variant 1. All three variants encode the same protein.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC049975.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN00849388, SAMN01164135
                                           [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-77                AK150157.1         2-78
            78-1246             AK150157.1         291-1459
            1247-1825           BC139132.1         1307-1885
            1826-2036           AK138954.1         1998-2208
            2037-2042           AC142112.3         76336-76341         c
FEATURES             Location/Qualifiers
     source          1..2042
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="12"
                     /map="12 53.65 cM"
     gene            1..2042
                     /gene="Serpina3f"
                     /gene_synonym="2A1"
                     /note="serine (or cysteine) peptidase inhibitor, clade A,
                     member 3F"
                     /db_xref="GeneID:238393"
                     /db_xref="MGI:MGI:2182838"
     exon            1..77
                     /gene="Serpina3f"
                     /gene_synonym="2A1"
                     /inference="alignment:Splign:2.1.0"
     exon            78..696
                     /gene="Serpina3f"
                     /gene_synonym="2A1"
                     /inference="alignment:Splign:2.1.0"
     CDS             90..1427
                     /gene="Serpina3f"
                     /gene_synonym="2A1"
                     /note="antitrypsin; alpha-1 antiproteinasin; serpin A3F"
                     /codon_start=1
                     /product="serine protease inhibitor A3F"
                     /protein_id="NP_001161767.1"
                     /db_xref="CCDS:CCDS26149.1"
                     /db_xref="GeneID:238393"
                     /db_xref="MGI:MGI:2182838"
                     /translation="
MAGVSPAVFGCPDVTLGRNTAVREVQENITSVDSLTLASSNTDFAFSLYKELVLKNPDENVVFSPFSICTALALLSLGAKSNTLKEILEGLKFNLTETPEPDIHQGFRYLLDLLSQPGNQVQISTGSALFIEKHLQILAEFKEKARALYQAEAFTADFQQPLEATKLINDYVSNHTQGKIKELISDLDKRTLMVLVNYIYFKGKWEMPFDPDDTCKSEFYLDENRSVKVPMMKINNLTTPYFRDEELSCTVVELKYTGNASAMFILPDQGKMQQVEASLQPETLRNWKDSLKPRLINELCLPKFSISTDYSLEHILPELGIRELFSTQADLSAITGTKDLRTSQVVHKAVLDVAETGTEAAAGTGYQNLQCCQGVIYSMKIYFDRPFLMIISDTNTHIALFMAKVSNPESDENFLNVEYAFPQVLEIMPEYRSVCTCCLPCLTRQ"
     misc_feature    168..1316
                     /gene="Serpina3f"
                     /gene_synonym="2A1"
                     /note="serpin family A member 3, alpha 1-antichymotrypsin;
                     Region: serpinA3_A1AC; cd19551"
                     /db_xref="CDD:381019"
     misc_feature    171..173
                     /gene="Serpina3f"
                     /gene_synonym="2A1"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (Q80X76.3); glycosylation site"
     misc_feature    369..371
                     /gene="Serpina3f"
                     /gene_synonym="2A1"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (Q80X76.3); glycosylation site"
     misc_feature    609..611
                     /gene="Serpina3f"
                     /gene_synonym="2A1"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000269|PubMed:16944957; propagated from
                     UniProtKB/Swiss-Prot (Q80X76.3); glycosylation site"
     misc_feature    864..866
                     /gene="Serpina3f"
                     /gene_synonym="2A1"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (Q80X76.3); glycosylation site"
     misc_feature    order(1152..1190,1194..1205,1209..1211,1221..1247)
                     /gene="Serpina3f"
                     /gene_synonym="2A1"
                     /note="reactive center loop (RCL); other site"
                     /db_xref="CDD:381019"
     misc_feature    1158..1235
                     /gene="Serpina3f"
                     /gene_synonym="2A1"
                     /note="propagated from UniProtKB/Swiss-Prot (Q80X76.3);
                     Region: RCL"
     misc_feature    1200..1205
                     /gene="Serpina3f"
                     /gene_synonym="2A1"
                     /note="Reactive bond. /evidence=ECO:0000250; propagated
                     from UniProtKB/Swiss-Prot (Q80X76.3); other site"
     exon            697..970
                     /gene="Serpina3f"
                     /gene_synonym="2A1"
                     /inference="alignment:Splign:2.1.0"
     exon            971..1121
                     /gene="Serpina3f"
                     /gene_synonym="2A1"
                     /inference="alignment:Splign:2.1.0"
     exon            1122..2042
                     /gene="Serpina3f"
                     /gene_synonym="2A1"
                     /inference="alignment:Splign:2.1.0"
     regulatory      2020..2025
                     /regulatory_class="polyA_signal_sequence"
                     /gene="Serpina3f"
                     /gene_synonym="2A1"
                     /note="hexamer: AATAAA"
     polyA_site      2042
                     /gene="Serpina3f"
                     /gene_synonym="2A1"
                     /note="major polyA site"
ORIGIN      
agcagaccaggaaggcagcagccctgcccaccaggagccagctaccacagacactggcctttgctccagctctgcaggagaagagagtaatggctggtgtctcccctgctgtctttggctgcccagatgtcaccctgggaaggaacactgcagtccgtgaagtccaagaaaatatcacatcagtggacagtttaacactggcctccagcaacactgactttgccttcagcctctacaaggagctggttttgaagaatccagatgaaaatgttgtcttctccccattcagcatctgcactgccttggccctgctgtccctgggagcaaagagcaacaccctgaaggaaatcctagaaggtctcaagttcaacctcacagagacccctgaaccagacatccaccagggctttaggtacttgctagaccttctcagtcagccagggaaccaggtacagatcagcacaggcagtgccctgtttattgaaaagcacctgcagatcctggcagagttcaaggagaaagcaagggctctgtaccaggctgaggccttcacagcagatttccagcagcctctcgaggccacaaagctcatcaatgactatgtgagcaatcacacccaggggaagatcaaggaactcatttcagacctggataaaaggacattgatggtgctggtgaattacatctactttaaaggcaaatgggagatgccctttgatccggatgatacatgtaagtctgagttctacttggatgagaataggtctgtgaaggtgcccatgatgaaaattaataacctgacgacaccctacttccgggatgaggagctgtcctgcactgtggtggagctgaagtacacaggaaatgccagtgccatgttcatcctcccggaccagggcaagatgcagcaggtggaagccagcttgcaaccagagaccctgaggaattggaaggactctctgaagcccaggttgataaatgagctctgcctgcccaagttctccatctccaccgactacagcctggagcacatccttcctgagctgggcatcagggagctcttctccacccaggctgacctgtctgcaatcacaggaaccaaggatctgagaacttctcaggtggtccacaaggctgtgctggatgtggctgagacaggcacagaagcagctgctggcacaggatatcaaaatctccaatgttgtcaaggtgtaatctactctatgaaaatatatttcgacaggccattcctgatgattatctctgacacaaacactcatattgccctctttatggcaaaagtttcaaatccagagagtgatgagaacttcctaaatgtggagtatgcttttccccaagtgctggaaattatgcctgaatataggtctgtctgcacatgttgccttccatgtctgactagacagtgacactgaccaattctgtcacgtcctcatgcagagaaacaagcctatgactggttattgtcagactccctgtcataatggtagcactaaatcaagttcctgacctgaaatttttgttattccccgtccctgctgtctccactgtatctgcttcaactcaaaagactgggaccgtcagtgaggctctctcctaacttaggctctgcttatgtctgccttcagcttttcagtaatgatgggactatacaagtttacaggccaacccataaggtttaagaagggaacctgcaactgtggtcctatctgcagcatctgaaatgtttggtgcccagttctaccttactcttgccttcctctgggcagagctattctcagtccctgcatagtctcctggccccacccagatctgatacaggtggagccctcacccctgcagctgcatggggctgtgggtcagggtagttcttctacccctagcactcctaatcaggacagagaagtcgcctaaccctaagtgtctagttgaccaaccacacaagacagatggacacctccaccttcatcacacaaattgaaagggcaggagctaaggatcaataaacatgtaactgcattgaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]