GGRNA ver.2 Help | Advanced search | English    旧バージョン

2022-01-24 11:53:36, GGRNA : RefSeq release 209 (Nov, 2021)

Summary:

Results:

検索語に色がつきます重なると色が濃く表示されます。

PREDICTED: Sebastes umbrosus solute carrier family 45 member 3 (LOC119475566), mRNA. (4402 bp)
acaaacagacacttagacccggtaagggtcaaggtcaccgtgacctcacgtccgtcccattctggtgaaatctcaggaacgccttgagctaatttcttcaaatttggcagaaacttcctcttggaatcaaggatgaactcattagattttggtagtcaaaggtcaaggtcactgtgaccttacatccgtctcattctcatgaaagcattatctcaggaacactttgagcaaatgtcttcaaatttggtacaaacttccacttcgactcaaggttgaactgattaggtcaaaggtcactctgacctcacgtccgtcccattctagtgacatctcaggaacgccttcagcgaattccttcaaattttgcaccaacatccacttcaacaaggatgaacttattatattttgtttgatgaaggtcaaaggtcaccgtgactttacgactgtcccattctcgtgatattttgggatcgccttgatcaaatttcctcgaatttggcgtaaacatccatttcatcaaggtgaagtgattaaatttttttggttaaaggtcaaggtcaccatgacctcacactcgtcccattctcatgaaatcttggg...
position 2181 2281 2540 2804
XM_037748436.1 - Sebastes umbrosus (honeycomb rockfish) - NCBI
PREDICTED: Sebastes umbrosus FXYD domain containing ion transport regulator 5 (fxyd5), transcript variant X1, mRNA. (1260 bp)
gggattggaagtgggataaagatttcgtctatggtgagaagctacatttgactgtgtttttatgtctgtccagtccatccaacgcctggagggaattccttcaaatttggcacaaacttcaacttggacttgtggatgaacgaattcaattttggtggtcaaaggtcactgtgacctcacgtccatcccaatcgtgatatctcaagaacgccttgaaggaatttcttcaaacttggcacaaacgtccgcttttactcaaggataaagtgattacatttagatgttcaaaggtcgaggtcactgtgacctcacgtctgtcccattctcatgctatctcaagaatgccttgaacgaatttcttcaaatctggcacaaacatccaattggactttaactgttaactgtttacaatttggtggtcaaaggtcattgtgacctcacaaaaaaacatttttggctttaactcaaggatccaaatgttaaatatgacaatttcacacaaatgtggaataggataaaatgatgaagtgatgaccttttagacagacatggatgtaaactgcaacttgactggctggcggaggcatacaaccgctaagt...
position 802 1063
XM_037785583.1 - Sebastes umbrosus (honeycomb rockfish) - NCBI
PREDICTED: Epinephelus lanceolatus cysteine-rich and transmembrane domain-containing protein 1-like (LOC117264835), mRNA. (1824 bp)
gaccttttgaccttcattattttatcctgttagacatttgtgtcaagttcggtcagaattagtgaaagaatccttcagttatggccaaaaacacgtttgtgaggtcacagtgaccttggcttgtgtccaatctgacgtttgcgccaaattgaatagaaatcccatcaaagccgtcttgagtcacagggttcagaagaatgagacagacgtaaaggcacagtgacctttgaccttcaaattctaatcagctcattgttaagtccaagtgaaagtttgtgccatatttgaagaaattcccctgaggcattcttcagacatcgtgtcgacaaagatgagtcagacgaggtcacactgacctttttaccactaaagtctaatcagttcattgttcagtccaagtggacgttcatgccaaatttgaaaaaaaaacaaaaaaaaccttgaggtgttctcgagaggtcatgttagcgagaatgaaatggacgaggtcacggtgacctttaaagagataatcaccaaagtctaatcaggtcatcgtggagccccagtgaaagtttgtgccaaattaaaaaaaaaaatcccttaaggtttctgagatgt...
position 814 1056 1198
XM_033639127.1 - Epinephelus lanceolatus (giant grouper) - NCBI
PREDICTED: Plectropomus leopardus palmitoyltransferase ZDHHC14-like (LOC121955303), transcript variant X3, mRNA. (2994 bp)
cggtcagctcagtttcacgtacggagttcagttacggcccacaacacgatttgtgagctccgagaccttcgaccaccaaattctaataagtttgccattgagttcaactggacctttttgactcatcccgttcacgaaaatgaccgatgcaaggtcacagtgaccttgaccttgacctttaacctttgacaaccaaattctgatcagacagagatttgtgtcaaatttgaacaatttttgagactccctcaaaaattcttgacatattgttttcaggattatgagacagatacaaggtcacagtgacctttaacctttgaccaccaaattgtaatcagtttattgcagagtccgagtggctgtttgtgctatatttgaaagaattccctcaaggtgtttttgacatatcacgtcaacaagaatgacatggaggtgaggtcaccgtgacctttgaccaccaaaatctaatcaaaccattgctgagtccaagtggaagtttgggccaaatgtgaagaaataccctcaagtttttctttataaatgagtcagacgcaagatcacagtgatctttgaccttcaacctctaaaatctaaccagat...
position 2449 2733
XM_042503186.1 - Plectropomus leopardus (leopard coralgrouper) - NCBI
PREDICTED: Gigantopelta aegis uncharacterized LOC121371050 (LOC121371050), mRNA. (1963 bp)
tatttttgaataatgtaaagtaatgtgttttcttcttgttagtgatcattgtttatatgcccatctatagtgggtagtattatggtgtggtgttgtgcgtccattcatccgtatgtccgtctgttaattttttcttgtccggatcatatcttgcatacaggaccatcaaacctcacatgtaggaacaacttgggatggtggtgtgttgcgttctactactaggtcactgtgacctacttttcatggtctactgcacataacaataaatccttgttttgatcatatcttgcatacagatgaatacaggaccatcatatgtcacatgtaagaacaacttgggatggcggtgtgttgcgttctattactaggtcattgtgacctacttttcacagtctactgcacataacaataaatccttgtccagatcatatcttgcatacaga
position 1741 1887
XM_041496673.1 - Gigantopelta aegis - NCBI
PREDICTED: Plectropomus leopardus palmitoyltransferase ZDHHC14-like (LOC121955303), transcript variant X2, mRNA. (3358 bp)
cggtcagctcagtttcacgtacggagttcagttacggcccacaacacgatttgtgagctccgagaccttcgaccaccaaattctaataagtttgccattgagttcaactggacctttttgactcatcccgttcacgaaaatgaccgatgcaaggtcacagtgaccttgaccttgacctttaacctttgacaaccaaattctgatcagacagagatttgtgtcaaatttgaacaatttttgagactccctcaaaaattcttgacatattgttttcaggattatgagacagatacaaggtcacagtgacctttaacctttgaccaccaaattgtaatcagtttattgcagagtccgagtggctgtttgtgctatatttgaaagaattccctcaaggtgtttttgacatatcacgtcaacaagaatgacatggaggtgaggtcaccgtgacctttgaccaccaaaatctaatcaaaccattgctgagtccaagtggaagtttgggccaaatgtgaagaaataccctcaagtttttctttataaatgagtcagacgcaagatcacagtgatctttgaccttcaacctctaaaatctaaccagat...
position 2813 3097
XM_042503185.1 - Plectropomus leopardus (leopard coralgrouper) - NCBI
PREDICTED: Plectropomus leopardus palmitoyltransferase ZDHHC14-like (LOC121955303), transcript variant X1, mRNA. (3436 bp)
cggtcagctcagtttcacgtacggagttcagttacggcccacaacacgatttgtgagctccgagaccttcgaccaccaaattctaataagtttgccattgagttcaactggacctttttgactcatcccgttcacgaaaatgaccgatgcaaggtcacagtgaccttgaccttgacctttaacctttgacaaccaaattctgatcagacagagatttgtgtcaaatttgaacaatttttgagactccctcaaaaattcttgacatattgttttcaggattatgagacagatacaaggtcacagtgacctttaacctttgaccaccaaattgtaatcagtttattgcagagtccgagtggctgtttgtgctatatttgaaagaattccctcaaggtgtttttgacatatcacgtcaacaagaatgacatggaggtgaggtcaccgtgacctttgaccaccaaaatctaatcaaaccattgctgagtccaagtggaagtttgggccaaatgtgaagaaataccctcaagtttttctttataaatgagtcagacgcaagatcacagtgatctttgaccttcaacctctaaaatctaaccagat...
position 2891 3175
XM_042503184.1 - Plectropomus leopardus (leopard coralgrouper) - NCBI
Pyricularia pennisetigena uncharacterized protein (PpBr36_01609), partial mRNA. (285 bp)
Sinica, 128 Academia Road, Sec. 2, Nankang, Taipei 11529, Taiwan atgacatcagtggtcccacacaagtgtggcgacaatggagggttccgctgcgccaagcccccccggccttctcccggcagtacagtacaaccaaacggaacgccatgcgaggtgttgcaaaagccgatttcccatcccatcctgcacgaagggtccaactcgcctcatgacgttcccgcctccttcagcggtagcggttggatcgccgagacaaacaaggacgaggtcatcgtgacctgccgcagcttagtacaccaccgcgccaaacctcattcagttcgttga
position 224
XM_029888794.1 - Pyricularia pennisetigena - NCBI
PREDICTED: Pecten maximus PDZ domain-containing protein 11-like (LOC117329806), mRNA. (2474 bp)
ctggcacgtccttaaatgaccctggctgttaataggacgttatgcaaaaacaaccccaaaaatacaaacctcatgtactacatataactggtagtttatacagtaattagggcattggttcatctaggtcatgtataccagaaataggtcactctgacctatattttgacatttgatcttcattacagaatctgatgaagtttgtcaggtctttattctctacattctgcttgtaactggaacttggagcatcgtttgacctagatgaggtggtgtgtcatgtatcaaaattaggtcattgtgacctacattttgatatttgatctacattacagatacagtttgtcagggttctattttcttcaatctacttatcactggaactttgtacttggggcatggttcaacatatatgaggtggtgtgtcatgtatcaaaagtaggtcactttgacctacattttgaattttgacctacatcaaagaaaaggtctgtctgttcataggatatgatttacatttgacggggaactgtgatttgccagctattcttgtttacattaatcttgttttttttttcaattaattacaccagatgtatc...
position 1876 2023 2171
XM_033887958.1 - Pecten maximus - NCBI
PREDICTED: Scophthalmus maximus Fas apoptotic inhibitory molecule 2b (faim2b), transcript variant X2, mRNA. (2555 bp)
tcaatattgtcatcattaaaataaacctcactcatgaacagtggtgtgcctggcttgcatgtaaaagacgatagatgtcattactgcagttctgtgttatgacattcaatcatttctgcacaactctgtgccgagacccccagatttacctcaactgcctcaagatctttgctttgactccaccgatctgctgagatatcatggcaaccaggccaaacaatttgtatcaggtcacagtgaccttgaccttctgatcagaacatctgtgagtgtttttgaatgtttgtgccaaatctgaagaaaccccttcgaggctgtcttgaaatattgcattcaagaggccaaaatgtgttttgtgaggtcacaatgaccttagctcaacttaagagtcaaagggaatatttatgccaaatgagtgtttcttatttttgtcctctgcccagagccgcatgtctcctcacctctcacacctaacatgcctaacagggcacttcttcacctgatctcctacactttgtcctacagaacatattgagctgtcggttcttaaccctcccataatagtcagggttcagtagcaatttctgctctaacatgcaa...
position 2101 2231
XM_035630396.1 - Scophthalmus maximus (turbot) - NCBI
PREDICTED: Scophthalmus maximus Fas apoptotic inhibitory molecule 2b (faim2b), transcript variant X1, mRNA. (2556 bp)
tcaatattgtcatcattaaaataaacctcactcatgaacagtggtgtgcctggcttgcatgtaaaagacgatagatgtcattactgcagttctgtgttatgacattcaatcatttctgcacaactctgtgccgagacccccagatttacctcaactgcctcaagatctttgctttgactccaccgatctgctgagatatcatggcaaccaggccaaacaatttgtatcaggtcacagtgaccttgaccttctgatcagaacatctgtgagtgtttttgaatgtttgtgccaaatctgaagaaaccccttcgaggctgtcttgaaatattgcattcaagaggccaaaatgtgttttgtgaggtcacaatgaccttagctcaacttaagagtcaaagggaatatttatgccaaatgagtgtttcttatttttgtcctctgcccagagccgcatgtctcctcacctctcacacctaacatgcctaacagggcacttcttcacctgatctcctacactttgtcctacagaacatattgagctgtcggttcttaaccctcccataatagtcagggttcagtagcaatttctgctctaacatgcaa...
position 2103 2233
XM_035630395.1 - Scophthalmus maximus (turbot) - NCBI
PREDICTED: Fundulus heteroclitus uncharacterized LOC118557761 (LOC118557761), ncRNA. (574 bp)
uncharacterized LOC118557761" /db_xref="GeneID:118557761" ORIGIN // aggacaggagtgtttgacccttggtcgcaacgagttgggctgaattgttttcactttaattgccttctaaaatagaaggcaattaatttttttcttcacttcatcgcttgtgtgcctacaaggatatttttgccacggagacctttttactgaaaggttcgaagattttattacagttgacttctgctttgaccgtgacctctttagtattagatttcaggtcataatgacctggatttacactaaaagataccatgagattattctactgcaggcaacctgtccaaggtgtcccccaccactcaaccaatgaccgctggagatggacaccaggcactcccccaaccctacaacgataagcagatgattttacaccattacggtctgccagtgggagggtttccgtggaacaattcttctgaaaggaatccccggggacgcactcattcatatgatgtgtttcaacatagtgtttgagctgggaattgtcctgcgacgtgatgtactgcagtcataagagcagctgttgaga...
position 219
XR_004927981.1 - Fundulus heteroclitus (mummichog) - NCBI
PREDICTED: Sebastes umbrosus zinc-binding protein A33 (si:ch73-54f23.4), mRNA. (2654 bp)
tagaatattaattgacaattattttgatcatcaattaatggttagtaggaataatctttcaagcaactaaaattactgcctcacagttgttttcctccaccaaccagtcaggttgcagtttacatccatgtctgtccgaaatgtcatctcttcatcgttttatcctgttagacattagtgggaaattgtcatgattatcatgtgaaatcttgagttatggccaaaaacgtgttttgtgaggtcacagtgacctttgaccttgagtcaaagtggatgtttgtgcccaatttgaagaaattccctcaaggcgttcgagatattgtgttcatgagaatgggacatacgtaaggtcaccgtgaccttgacctttgacctttgactatcaaattctaatcagttcatccttgagttcgggtggacggttgtgctaaatctgaggaaattccctcaaggcgatcctgagataacacacatttgtcactatactctgacatattctagacaaactgatgaattgattgacagatttttcgataaagaattatataatgtactcacaacttgctggagagtgttgcaaatagagaaactccacatcaa...
position 1590 1699
XM_037785959.1 - Sebastes umbrosus (honeycomb rockfish) - NCBI
PREDICTED: Tachyglossus aculeatus U6atac minor spliceosomal RNA (LOC119943154), ncRNA. (124 bp)
snRNA" /gene="LOC119943154" /product="U6atac minor spliceosomal RNA" /inference="COORDINATES: nucleotide motif:Rfam:12.0:RF00619" /inference="COORDINATES: profile:INFERNAL:1.1.1" /db_xref="GeneID:119943154" /db_xref="RFAM:RF00619" ORIGIN // gtgctgtaggaaaggagaaaggttagcactcccctggaggatggaagaggtcatagtgacctttacaacacatgtaaggttaagatattgccaccgacttcatagcatctaaccatgttttaga
position 48
XR_005455629.1 - Tachyglossus aculeatus (Australian echidna) - NCBI
PREDICTED: Zonotrichia albicollis uncharacterized LOC113460778 (LOC113460778), ncRNA. (617 bp)
gtcagtgtgacctgaagctcaggcagctcttcctgggggagaacaacccagaacaggaataaaaaaggagattcaccctcagtggaaccaggacctcaaaactgaggataaacccccacaattcctgtgaaagggaagatgttaagtgcaatccatgaggaattccctgactcagggagattttgccttgaggtcaatgtgacctgaacctcaggcagttctagctggcagagaacaacccagatcaggaataaaaaggagattcacccccagtggaaccagaatgtcagaactgaggataaacccccacaatttctgtgaaaggggagatgttaaatgcaattcaagaggaggaattccctgacacagggagattttgccttgaggtcagtgtgacctaagctcaggcagctcttcctcggggagaaaaacccagatcaggaataaaaaaagagattcacccccagtggaaccagaatgtcagaattgaggataaatcaccccccaattcccatgaaaggggaggaattccctgacacagggagattttgcctcgaggtcagtgtgacctgaaggtccaagctcaggcagcttttcctg...
position 191 385
XR_003382616.1 - Zonotrichia albicollis (white-throated sparrow) - NCBI
PREDICTED: Epinephelus lanceolatus pinopsin-like (LOC117249974), mRNA. (2583 bp)
atgtttaaacataagaataaatgcttcgctattaacgaaggcattttcagagagtccgtcctcatcaacgtgatcgctacagagcgcaccagggcaatatcctcagatttggcacaaacatccacgcggacgcaacaatgaataaatcagaatttggtggtcgaaggtcattgtgaccttgcatctgtttcatttttgtgagtgcaatatctcaagaaggccttgaggtaagttccttaaattttgacaagaacgtccacttggactaaatgataaactgattagaatttggtggtcaaaggtcaaggtcatccatcttgttcttttgggtgccatatctcaagagggccttgaatttcttcagatttggcaccaacggccatcttgactcaacgataaactaattagaagttagaggttgaaggtcactgtgaccttgtccatctcattcttgtaaatgtgatatctcaagaaggccttgaggtgagttcctgaaatttggcacaaacattcatttggactcaacaataaactgataagaatttggtggtcaaaggtcaaggtaactgacctcacaaaacttcctaactcaacccttca...
position 1970 2228
XM_033615908.1 - Epinephelus lanceolatus (giant grouper) - NCBI
PREDICTED: Gigantopelta aegis F-box only protein 16-like (LOC121377468), mRNA. (4741 bp)
catggtcttctaagaaaacccgctacgttcttcttccgttagtagcacgggatcttttattatctgctttgtcttattgtggtattgcattttctgtccgtccatgtcagtccgtaaaatgtgcatttcagggccatatcttttgtatcatttcatattggatcatcaaatgttacatgcaagtacaacttgggatggcagtgtgtcgcataccgtaactaggtcactatgacctacttttgatgcattactgtacattaaagaaaatcgttgccagggcaatactttccttgtcaattcatataagatcatcaaaccttacatgcaagtacaagttgggatggcagtgtgtcacataccataactaggtcaccatgacctacttttcatgcattgctgtacattaaagaaaatcgtttcaagcaatactttccttatcaattcatataagatcaccaaaccttacatgcaagtacaacttgggatggcggtgtgtcacataccataactaggtcaccatgacctacttttgatgcattgctgtacattaaaggaagtcgttgccagggcagtatcatccttatcaattcatataggatc...
position 4262 4408
XM_041505470.1 - Gigantopelta aegis - NCBI
PREDICTED: Ipomoea nil heavy metal-associated isoprenylated plant protein 32-like (LOC109153142), mRNA. (424 bp)
gctgttcactcattcaacaatggagccatacgctgacgccagttgtattctgagagtggatattaattgtgatgcgtgcaaattcaaaatgattgaagttataagttcggtcgcgggtgtgtattcaattagcattgatgcagaggaaaatttggtaaaaatttgtggggaggtggaccctaatcgtctcttgagtgcattagcaagagaaggtaaacatgcaaaaatagtaatggctaacctaaaacaccctcaactaagactacatccaagatatggctatatccaaggtcacgatgaccttggcaatggaggcggccatggctatcaccctcaccaagccttccctataagaggggcactccctcaccattcatactatccataccattatccatcgtgctatataaggtttggaaattag
position 289
XM_019300941.1 - Ipomoea nil (Japanese morning glory) - NCBI
PREDICTED: Scleropages formosus C-C motif chemokine ligand 28 (ccl28), mRNA. (487 bp)
cagttctcttgctcctgtgcgccacctttaccatcagtgaaggtggaattccaaggtgctgtgtgaagataagtcaaaaaatccctcaacgcttactgaaacacgtggagaagtatgacttccaaacgtcctctggattttgtgacattcctgctctggtactgtacatgaaacggaagaaattctgcgctgaccccagcctcataaataaggtgataaatgcgataaataaaagaagaaaacaggtaccgcaggacctgttcggaatgattaagtaaatggtgtgtggtggaaggtcatggtgacctctgaattgcttccttaatataatcttcatttctatgacctatggaatggtctggtgtcatgcgtttttccttatgaagtttggtgaaaattttcactcttgtattatgttttactgcatgtcgtacccagatttttgatatcttgtgatgttctgtacaa
position 313
XM_018759114.1 - Scleropages formosus (Asian bonytongue) - NCBI
Helobdella robusta hypothetical protein partial mRNA. (168 bp)
A., Putnam,N.H., Grigoriev,I.V. and Rokhsar,D.S. CONSRTM DOE Joint Genome Institute TITLE Direct Submission JOURNAL Submitted (18-DEC-2012) DOE Joint Genome Institute, 2800 Mitchell Drive, Walnut Creek, CA 94598-1698, USA aatggcgactacgttgaaattcaaacctctttcgggctgaccgtgtcatacaaccccctgtggaggttaaaggtcacagtgacctccgccttcagtaatcaagtgaccggaagttgcggaaattttgacggaaatccaagtaatgatgtcaaaatggtgaacggcgct
position 71
XM_009030703.1 - Helobdella robusta - NCBI
PREDICTED: Dasypus novemcinctus galectin-2-like (LOC111762579), mRNA. (570 bp)
ggggaaggagcttgtggtagatcatctgtgctttgcgcgagggtcagagatcacggagacatttgaagttacaaatatgccccgtattttcgggacatccctgaagatcaagggcaaaattgccaaagatgctgattgctttgcgattaatctgggtgaagggcccgagaagcggggcctgcacttcaaccctcgctacgacaggtcctccattctcctcaactcatttgagtgcggatgggggaaggagcttgtggtagatcatctgggctttgcccaagggtcagagatcaaggtcataatgaccttggatagtgacggattcaaggtgacgctgccagacgggcaccagatcagcttccctaacaggctgggcctctcccaggtgccctacctgagagtggaggggggtcccgtcatcaccctcattgggtaa
position 428
XM_023586884.1 - Dasypus novemcinctus (nine-banded armadillo) - NCBI
PREDICTED: Heterocephalus glaber uncharacterized LOC110350447 (LOC110350447), ncRNA. (526 bp)
genomic feature by RNAseq alignments, including 1 sample with support for all annotated introns" /db_xref="GeneID:110350447" ncRNA 1..526 /ncRNA_class="lncRNA" /gene="LOC110350447" /product="uncharacterized LOC110350447" /db_xref="GeneID:110350447" ORIGIN // gtatgtcaccatatagggaaatccccattgaggtcactatgacctggggacttggggccatcaccttggtcactttctaatacctgccacaggcctaaacactcacccttgccatgtgatgtttcgatgatccagtctacaaataattgaagagacattgatcccttaaattgaggggatgaatgcagaagatgatgacagagtgagtgtgagcatgagatgttattttacttcaagttcatggtcaaatactgtccccagagtacccctcatggggccactcagctacacacagagaaagctgtgagagttgtcaggcctgagccagaggcatcagccca...
position 31
XR_002397038.1 - Heterocephalus glaber (naked mole-rat) - NCBI
PREDICTED: Penaeus japonicus uncharacterized LOC122256289 (LOC122256289), mRNA. (388 bp)
tccgtcaggcatcatggccatgcagtcggacgctgaattcttcttcgtcggttcttccgtcaactacacatgccccgaaaagaccatgtcctccgacggctctacctacacgacaattacttacaatgccacaggctggtccccgatcgatcccaatttccaatgtttgaacatatgccttggagacccgcccacagcgccgcccttcgtcagcagcgacttcgccggagcgagggcgtggggaaccgtggtcacctacacctgccagtttgcgttccggggagcaggagccgaggtcacggtgacctgcgacgagggatcctggtggcccaactctctccccgcctgcataggaataattagaggcagatga
position 309
XM_043020845.1 - Penaeus japonicus - NCBI
PREDICTED: Nothobranchius furzeri mitochondrial ribosomal protein L49 (mrpl49), mRNA. (660 bp)
attcctccatctcgagttcccgctccgcctaaacacgccggagccgccccgtccggatggatccctccggccgagtctccgccggatctaccgtacatgatccgccgctcccgcatgcacaacatcccggtttacacggacctgactcacggtaaccgcaagatgacgctggtgcggaaggtggagggggacatatgggctctggagaagcacgtgaaggagtacctgaaggaggtgacggggaaagagctgcccacgcaggtcaacgaggtcaccatgacgctaaaggtcaaaggtcactatgacctggagctgaaggagtggctggccagcagaggcttctgaccgtggagctgcatcagcttttcttgtgtagagacggtctgataatgttcatgtcggctgttgcctcattaaacatggctgctgtgacccag
position 517
XM_015968871.1 - Nothobranchius furzeri (turquoise killifish) - NCBI
PREDICTED: Gigantopelta aegis uncharacterized LOC121386920 (LOC121386920), transcript variant X2, mRNA. (1803 bp)
gtagtactaataatctataacctagatacttgcaggaggtactctgttagttcaagactgtaaatcagggcagaagagagcaaatgggacagcttccctttacttggaggcacgttactatagaatatcgctctttgacgggttgtattatggtatggtgaacattgtctgtccgtatgtctgatcataaagtgttcatttccggagcatatcttttttaccaattcaaataaaatcttcaaacctaggatgtaagtacaacttgagaatgcagtgtgtagtgtaccataactaggtcactgtgacctacttttcatgcattactgcacattaaaggaaatcttcaaacctaggatgtaagtacaacttgggaatgcagtgtgtagtgtaccataactaggccgtcatgacctacttttcatgcattactgcacattaaaggaaatcttcaaacctaggatgtaagtacaacttgggaatgcagtgtgtagtgtaccataactaggtcactgtgacctacttttcatgcattactgcacattaaaggaaatcttcaaacctaggatgtaagtacaacttgagaatgcagtgtgtagtgta...
position 1311
XM_041517971.1 - Gigantopelta aegis - NCBI
PREDICTED: Gigantopelta aegis uncharacterized LOC121386920 (LOC121386920), transcript variant X1, mRNA. (1819 bp)
gtagtactaataatctataacctagatacttgcaggaggtactctgttagttcaagactgtaaatcagggcagaagagagcaaatgggacagcttccctttacttggaggcacgttactatagaatatcgctctttgacgggttgtattatggtatggtgaacattgtctgtccgtatgtctgatcataaagtgttcatttccggagcatatcttttttaccaattcaaataaaatcttcaaacctaggatgtaagtacaacttgagaatgcagtgtgtagtgtaccataactaggtcactgtgacctacttttcatgcattactgcacattaaaggaaatcttcaaacctaggatgtaagtacaacttgggaatgcagtgtgtagtgtaccataactaggccgtcatgacctacttttcatgcattactgcacattaaaggaaatcttcaaacctaggatgtaagtacaacttgggaatgcagtgtgtagtgtaccataactaggtcactgtgacctacttttcatgcattactgcacattaaaggaaatcttcaaacctaggatgtaagtacaacttgagaatgcagtgtgtagtgta...
position 1327
XM_041517970.1 - Gigantopelta aegis - NCBI
PREDICTED: Paralichthys olivaceus mitofusin-1-like (LOC109623919), partial mRNA. (630 bp)
gene="LOC109623919" /note="G1 box; other site" /db_xref="CDD:206648" misc_feature 419..421 /gene="LOC109623919" /note="G2 box; other site" /db_xref="CDD:206648" misc_feature 425..433 /gene="LOC109623919" /note="Switch I region; other site" /db_xref="CDD:206648" ORIGIN // acatgttacgttcacgatgaggtcactatgacctttgacctctgaaatctaatcaattcatctttcaaccagttttgaggaaattccttcgaggtgttgttgagatatcgtgttgacaagaaagaaacagcctctgaccactgggggtcgctggtgtaaacaatacaaacgtgacaatgtgacctgtgtttgttgcgtgatgtcagaggcatggcggagcgacgacctgggccaggtggcggtggaggagcagagcgtggacatgcagagctgtgccaccaaactgtcgaccatcagggacgttttgctgcggaggcacatgaaggtg...
position 20
XM_020078377.1 - Paralichthys olivaceus (Japanese flounder) - NCBI
PREDICTED: Glycine max uncharacterized LOC102661198 (LOC102661198), mRNA. (513 bp)
order(259..261,445..447) /gene="LOC102661198" /note="active site" /db_xref="CDD:259998" ORIGIN // atggacccagtcaagtacatatttgaaaagcccaccctcaccgaacagatcgctcggtggcaggttctattgtcagaattcaacattgtttatgtcacacaaaaggcaataaagggaagtgccttggaagactacttggctcagcagcccatcaatgactatcaaccaatgcaccccgagttccctgacgaggtcatcatgaccttgttcgaggaggagatgggggatgaagatagggagaaatggattgtgtggtttgacggcaagtccaacgcactaggccatagagtaggggcagttttggttacccccgatgatcaatgtatacccttcacagctaggttgggcttagactgcatgaataacatgtctgagtacgaggcatgcgcccttgggatccaagcagcaattgacttcaaggtcaagttgctcaaagtatatggggacttagcctttgtgatccaccaattgaaaggagaatgggagaccagggatcacaagt...
position 191
XM_006603341.1 - Glycine max (soybean) - NCBI
PREDICTED: Hippoglossus hippoglossus uncharacterized LOC117757739 (LOC117757739), ncRNA. (244 bp)
of the annotated genomic feature by RNAseq alignments, including 6 samples with support for all annotated introns" /db_xref="GeneID:117757739" ncRNA 1..244 /ncRNA_class="lncRNA" /gene="LOC117757739" /product="uncharacterized LOC117757739" /db_xref="GeneID:117757739" ORIGIN // gccaaaggtcaaaggtcacggtgacctcacagaacaaaaaatgagaaactgtcacagggaccccatataaatctggaaaaaaatacgcacacagtgcagtgtttctagttattgttattgtctgatccttttatataagaatggtaaagtctactgtcataatgtggtgttggttttaattcaagtattttatcaagtgtttcaatcattgaaatattgacataataaactgcatatatacaga
position 13
XR_004613194.1 - Hippoglossus hippoglossus (Atlantic halibut) - NCBI
Opisthorchis viverrini hypothetical protein partial mRNA. (474 bp)
Melbourne, Cnr Park Drive and Flemington Road, Parkville 3010, Australia atgggggcagttgctgggttgaatgcaaagcgcttctctagccacggtgacgggaaggatgatggggaatctgggcacagcaatcgcttagaagaaaatgtgtgcggccgcattatcggcatcggaaaagaggaaaaagccgaagcacatgatgtgttaattagtacgttagacgtgtcgttctgcgcgatggaatgtctcccagttggaatatttcaaggtcattatgacctactggtgctccgcaacgatggggctatagagtatgtgttcagcgcacttttcggtattttgaattatccattggaacaggtcggcttcggcagcgggtctattcggccgcttttcaggtgtatcttgccacttgcaaagctgcgtcccattcactactttcgacctccgaccatcttgaatggtatagacgttcccccagcgatcggtgactacgaacgtcccttgccatcgactgcctag
position 219
XM_009177955.1 - Opisthorchis viverrini - NCBI
PREDICTED: Glycine max uncharacterized LOC112999920 (LOC112999920), mRNA. (573 bp)
IV of spliceosomal protein Prp8; Region: RNase_H_like; cl14782" /db_xref="CDD:353835" ORIGIN // atggacccaatcaagtacatcttagaaaaacttgctctcattggatggatcgcttggtggcaggttctaccatcggaatttgacattgtttatgtcactcaaaaggcgataaaggggagtgccttggcagattacctggctcaacagcccatcaatgactaccagcctatgcatccagaattccttgatgaggtcatcatgaccttctttaagggggaagtagaggataaagatagggacaaatggattatgttgggttttgaatgcacaaacaacatagccgagtataaggcgtgcgcccttgggatccaagcaacaattcacttcaaggtcaagttgctcaaggtctacatcaggaagttgataggattctttgatgacatatcctttcatcacattcctagagaggagaatcagatggccaatgcccttgccactctagcatccatgttccaactaacctcgcatagggatttgccgtacatcaaattcagatgttgtggc...
position 191
XM_026126340.1 - Glycine max (soybean) - NCBI
PREDICTED: Dermacentor silvarum uncharacterized LOC119445864 (LOC119445864), mRNA. (477 bp)
ORIGIN // atgaggctgcaccaaggaggcatcacgcactactttgatgtgtggcatgtggcaaaaggtatccgcaaaaagattactgcgacatccaggaaaggtggttgcagttccctcaaagaatggatccaggcaattgtcaaccacctctactggtgtgcccgtgcatgtggtggcaatgcagacctggtggtggctgcatggggtagtattttcaaccacacagtcaacatccacgaaggtcacaatgaccttttccccaggtgccttcacggacctcctcgccgtatctcatggctcagtgcaggttctccagcatacaaggcactcaaggaaatcgtgacagcacctctactgctcagagacatacgtcagctgtcaccatcggcacagacgtacagccttgaatcatttcatagtgtgctcaacggctttgcacccaaattgactgcattcacatacgaaggcatgaaagctcggtag
position 234
XM_037710172.1 - Dermacentor silvarum - NCBI
PREDICTED: Alosa sapidissima uncharacterized LOC121693698 (LOC121693698), ncRNA. (124 bp)
the annotated genomic feature by RNAseq alignments, including 9 samples with support for all annotated introns" /db_xref="GeneID:121693698" ncRNA 1..124 /ncRNA_class="lncRNA" /gene="LOC121693698" /product="uncharacterized LOC121693698" /db_xref="GeneID:121693698" ORIGIN // caaagggatatacataaggtcacagtgaccttgacctttgacctttggctaccaaaatgttacaagttattatttgaatccaagtgactgtttctagccctgagatatgcctatgctggagaga
position 17
XR_006025555.1 - Alosa sapidissima (American shad) - NCBI
PREDICTED: Glycine soja uncharacterized LOC114391506 (LOC114391506), mRNA. (573 bp)
IV of spliceosomal protein Prp8; Region: RNase_H_like; cl14782" /db_xref="CDD:353835" ORIGIN // atggacccaatcaagtacatcttagaaaaacttgctctcattggatggatcgcttggtggcaggttctaccatcggaatttgacattgtttatgtcactcaaaaggcgataaaggggagtgccttggcagattacctggctcaacagcccatcaatgactaccagcctatgcatccagaattccttgatgaggtcatcatgaccttctttaagggggaagtagaggataaagatagggacaaatggattatgttgggttttgaatgcacaaacaacatagccgagtataaggcgtgcgcccttgggatccaagcaacaattcacttcaaggtcaagttgctcaaggtctacatcaggaagttgataggattctttgatgacatatcctttcatcacattcctagagaggagaatcagatggccaatgcccttgccactctagcatccatgttccaactaacctcgcatagggatttgccgtacatcaaattcagatgttgtggc...
position 191
XM_028352510.1 - Glycine soja - NCBI
PREDICTED: Prunus dulcis uncharacterized LOC117626505 (LOC117626505), transcript variant X3, ncRNA. (1929 bp)
gttctaatgggtgtctattataacatatccaaaatgcagccccattggataactctggagttcgtcacccatcaaacatagaaccatgctcaggatgaagtttgtgtacgctgccaaatgagttagcaatttgtttcggccttaacttcttcctccgaccttggattggcccaaataacatgtggttggaaagctgacattctgatcttcaagatggaggtctcaaagtcatcatttgcttaagggaatcccaattcatgagcccttgaagttgcaggtcatgctgacctaagtatgagctaagtgtgctaggtcattatgacctaagcatgaggtgttattgattgtggggaaattaggtgaagcagattcattacttttaatcggagtggagttttacagtagccaaaagaaagaaaagaagatgaagtgggagctgcagcactaagtctaaagagaagaagaattgttttcaaattcaattgtgtgttaggtgaagtgggtgtagttggtgaactcaattgtataatctgaaaaacctaacctcaggcctat
position 1650 1685
XR_004585582.1 - Prunus dulcis (almond) - NCBI
PREDICTED: Picoides pubescens aquaporin 8 (AQP8), mRNA. (774 bp)
ggggctgctgcagcctgccctcgcccacgggctggcattgggccccatcatctccatcctgggaggcatcagtggaggccacctcaaccctgcagcatccctggcagtgtggctggctggagggctgaacatcaccatgcttattccttactggctctcccagctctgtggaggggtgataggagctggcctggcaaaggctgtggtggagcaggagtcctacaggaattccacaggaggagccttcagcatcatcacaagtgatgagcaggtcccctctgccctggtgaacgaggtcatcatgacctccttcctgttcttggtggtctgcatgggagccgtcaatgggaagaccaagtccccgctggctccggtctgcatcggcttcaccgtcacagccaccgtgctggcaggaggcagcgtgtctggagcctgcatgaaccctgccagagcctttgggcccgcgctgctggccggctgctgggactaccactgggtgtactgggtgggacccactctggctgccctcctggtcagtgggacagtgaggctgctgctgggtgaccagagcacccgcctgatcctgaagtga
position 476
XM_009900537.1 - Dryobates pubescens (Downy woodpecker) - NCBI
PREDICTED: Cyprinus carpio triosephosphate isomerase A-like (LOC109112142), mRNA. (1231 bp)
" /db_xref="CDD:238190" polyA_site 1231 /gene="LOC109112142" /experiment="COORDINATES: polyA evidence [ECO:0006239]" ORIGIN // ccttctccatagtaggattcctaagttctctagcgggagtggatatactgcagtcggtgtgtttggtgaggtcggtttgtctcgcaataatgtcttcaagaaaattcttcgtcgggggaaactggaaaatgaacggcgataaggagagtttgggcgaggtcataatgaccttgaacacggccagtctcaacgatgaaacagaggtggtgtgtggagcaccatccatttatcttgattatgtgaggtctaagctggaccagaggatcggagtggccgcccagaactgctataaggtacccaaaggagccttcaccggggagatcagcccagcgatgattaaagactgcagtgtggactgggtcattctgggccattctgagaggcgtcacgtgtttggcgagagcgatgagctgattggccagaaagtggcccattgcctagagaacgatttgggtgtgattgcctg...
position 157
XM_042776241.1 - Cyprinus carpio (common carp) - NCBI
PREDICTED: Sparus aurata uncharacterized LOC115589880 (LOC115589880), ncRNA. (317 bp)
tcatcctcaaccacaaccagcaagtgatggtgctataattggccttgcagctttcattgctacgactgctgtcattggatttgctatattctggtgcctgtatggggcagaacactagattacaattttcttctgtcttaattttccaactcaggttttatgcctttgtagatgcaatagttggctcttgttttcaatctgtctgccccattctggccaacgcaatatctcagcgacaccttgagggaatttctcttggcaccatggatgtgctgattaaagttattggtcaaaggtcactgtgacctcacaat
position 297
XR_003985618.1 - Sparus aurata (gilthead seabream) - NCBI
PREDICTED: Rhagoletis pomonella uncharacterized LOC118737489 (LOC118737489), transcript variant X3, ncRNA. (642 bp)
product="uncharacterized LOC118737489, transcript variant X3" /db_xref="GeneID:118737489" ORIGIN // aaaaaggaatttttaagttttcagaaggttatgatcttcatctttgctgtttgtaagctacgtcatattagagtatgtacatagataagaaggcaggaaaataaagctggtaaatattcagatgaaaacgatgtcggtcgaattccgaaaaaccttcacgaattacttatatacatatgaatgtatgtatgtaggtcatcatgaccttcttgaatctgtttaaaccattacggtatgtctcggatcaatgtatgtagctcgatagagaacactcttcggttttcttttcgccgagaagtctcagttgttttacactggcggaagaactactttacgattaaaaatgctgcgtttagcgccatattcccccatgctaaaccccattgaaataatctggggaaaaatcaaaatgcatgtaaaggtgcacatctcaaacccagtcataaatgggccaaacgttgtttagcaacggctgcaatatttggagaagttggtggatc...
position 193
XR_004992821.1 - Rhagoletis pomonella (apple maggot) - NCBI
PREDICTED: Rhagoletis pomonella uncharacterized LOC118737489 (LOC118737489), transcript variant X1, ncRNA. (643 bp)
product="uncharacterized LOC118737489, transcript variant X1" /db_xref="GeneID:118737489" ORIGIN // aaaaaggaatttttaagttttcagaaggttatgatcttcatctttgctgtttgtaagctacgtcatattagagtatgtacatagataagaaggcaggaaaataaagctggtaaatattcagatgaaaacgatgtcggtcgaattccgaaaaaccttcacgaattacttatatacatatgaatgtatgtatgtaggtcatcatgaccttcttgaatctgtttaaaccattacggtatgtctcggatcaatgtatgtagctcgatagagaacactcttcggttttcttttcgccgagaagtctcagttgttttacactggcggaagaactactttacgattaaaaagtatataaatcaacgccatattcccccatgctaaaccccattgaaataatctggggaaaaatcaaaatgcatgtaaaggtgcacatctcaaacccagtcataaatgggccaaacgttgtttagcaacggctgcaatatttggagaagttggtggat...
position 193
XR_004992819.1 - Rhagoletis pomonella (apple maggot) - NCBI
PREDICTED: Rhagoletis pomonella uncharacterized LOC118737489 (LOC118737489), transcript variant X2, ncRNA. (655 bp)
product="uncharacterized LOC118737489, transcript variant X2" /db_xref="GeneID:118737489" ORIGIN // aaaaaggaatttttaagttttcagaaggttatgatcttcatctttgctgtttgtaagctacgtcatattagagtatgtacatagataagaaggcaggaaaataaagctggtaaatattcagatgaaaacgatgtcggtcgaattccgaaaaaccttcacgaattacttatatacatatgaatgtatgtatgtaggtcatcatgaccttcttgaatctgtttaaaccattacggtatgtctcggatcaatgtatgtagctcgatagagaacactcttcggttttcttttcgccgagaagtctcagttgttttacactggcggaagaactactttacgattaaaaagtatataaatcaatgctgcgtttagcgccatattcccccatgctaaaccccattgaaataatctggggaaaaatcaaaatgcatgtaaaggtgcacatctcaaacccagtcataaatgggccaaacgttgtttagcaacggctgcaatatttggag...
position 193
XR_004992820.1 - Rhagoletis pomonella (apple maggot) - NCBI
Talaromyces rugulosus uncharacterized protein (TRUGW13939_03761), partial mRNA. (561 bp)
AUTHORS Wang,B., Guo,L., Ye,K. and Wang,L. TITLE Direct Submission JOURNAL Submitted (13-JUN-2020) Faculty of Electronic and Information Engineering, Xi'an Jiaotong University, Xi'an, Xi'an, Shaanxi 7120000, China atgcagttctctctcgctaccattgccctccttgctggcgctgccgccgcccaggtcaccgtgacctccgttgacatcgagaccatcacctcgtgcgctcccaccgtcaccaactgcccagctcgtcagacctcgactgccccggccccggctcctccagctgtgactccttccggacctgctgttcctcctccggccgtcacctcggttgtgtcccagcctgctcctccggctccccctgctggcaacaccagccctgctccttaccccgtcgtctcgtcgcccccggctcctcaggtctcggtcatcaccgtcaccacctgcgtgcctaccaccagcctgtcgaccatcactctcactcccacccagg...
position 53
XM_035486940.1 - Talaromyces rugulosus - NCBI
PREDICTED: Cucurbita maxima paired amphipathic helix protein Sin3-like 3 (LOC111493793), mRNA. (952 bp)
db_xref="CDD:323741" ORIGIN // ttcgttctactgctcaactcttgctcattcgacaaagcttccgcagattttcttcagaaatgaagaaccgcggggaggcagatggcagtatccggaaattaacagcggaggatgccctagaatttctcaagaatgtgaaggacgtcattggaaacgagacggaaaaatatgaagaatttcttcaactcatgaaggatttagcgtttcaaagaattgacactgtgggcgtcataacaggggtaaagcgtctattcagaggtcataatgacctgattttgggctttaatacctttttgccacaaagatatgcaatagcttgtcctcttgaggatgaaacgcctcctcgaaggaggcggcctgttaaacttggagacgctttggaatatatcagtgaggttaagagacggtttgaaggtgagttccatatattcaattcatttatgagaaatttgcatttgtacaaaagaggaaaaaagcctctaagtgagctccaccgggaggtttgtgtactgatgcaagaccacccagaccttgttgagggttttgctgattttcttccttgtccttca...
position 257
XM_023143644.1 - Cucurbita maxima (winter squash) - NCBI
PREDICTED: Setaria italica uncharacterized LOC111256352 (LOC111256352), mRNA. (576 bp)
db_xref="GeneID:111256352" /translation="MDCPNTNPKRSEVTVTCPSDDAIVEILSRLPAKLRFRFKKFPQTLEGFFFGGSPYENYGHFVDLFGRPSPLVDASFSFLTGLPEIEKINLLGSCNGLLLFGHRRVSDMNDSLGYIVCNPATEQWVAVPSSGWTPSPLDDSACTYLIFDPAVSSHFQLVQFTQDDEGAILQFRRNADDNEVEGVAEVRTLLI" ORIGIN // atggattgccccaacaccaaccccaagaggagcgaggtcacggtgacctgcccctccgacgacgcaatcgtggagatcctctcgcgcctccccgccaagcttcgcttccggttcaagaaattcccccagactctagaagggttcttcttcggtggtagcccttatgagaactatgggcatttcgtcgatctgttcgggagaccctcgcccctcgtcgatgcttcgttctcgttcctcactggactgcctgagattgagaagatcaaccttttgggttcctgcaatgggctcctgctcttcgggcacagacgggtttcagacatgaatgactcactgggctatattgtgtgcaaccc...
position 35
XM_022824234.1 - Setaria italica (foxtail millet) - NCBI
PREDICTED: Cucurbita moschata paired amphipathic helix protein Sin3-like 3 (LOC111450349), mRNA. (970 bp)
db_xref="CDD:323741" ORIGIN // tttgttctactgctcaactcttgctcattcgacaaagcttccgcagattttcttcagaaatgaagaaccgcggggaggcagatggcagtacccggaaattaacagcggaggatgccctagaatttctcaagaatgtgaaggacgtcattggaaacgaggcggaaaaatatgaagaatttcttcaactcatgaaggatttagcgtttcaaagaattgacattgtgggcgtcataacaggggtaaagcgtctattcagaggtcataatgacctgattttgggctttaatacttttttgccacaaagatatgcaatagcttgtcctcttgaggatgaaacgcctcctcgaaggaggcggcctcttaaacttggagacgctttggactatgtcagtgaggttaagagacggtttgaaggtgagttccatatattcaattcatttatgagaaatttgcatttgtacaaaagaggaaaaaagcctctaaatgagctccaccgggaggtttgtgtactgatgcaagaccacccagaccttgttgagggttttgctgattttcttccttgtccttca...
position 257
XM_023090424.1 - Cucurbita moschata (crookneck pumpkin) - NCBI
PREDICTED: Micropterus salmoides arrestin red cell-like (LOC119911316), mRNA. (3757 bp)
ctcaagtaaatcgagtgcatttttatgactgcaccggccacagctgtggctggaggctgtatgttttcaggttgtctgttatctgtccgtcccattcttgtttttcagatgtggtgcaaacatccacttaaactaaagcatgaactgagttcattgagtttggtggtcaaaggtcaaggtcactgtgacctcacgcctgtcccattcacgtgaacgtggtatctcaggaatacctggagggaagtggcacaaacgtccactctgactccagaatgaagtgattttagtggtctacgctccactttattacattattcaacaccataactcaggaacagaaggtatgattgtcaccatatttcacagtgggttggacactgaataggtaacacttttgactgaaaggtcaaaggtcattgtgaccttaaaatacatttacacattttgggtagcactactctgtaagaacccatctttacatagtaatcgaatttatgtgtaccttttcaaccaatacatctatgaatagttccacaatgtatatttactggtatcatatcataaatatagtagtataattaccttttttcaaatcctagt...
position 1888 2122
XM_038730160.1 - Micropterus salmoides (largemouth bass) - NCBI
PREDICTED: Cucurbita pepo subsp. pepo paired amphipathic helix protein Sin3-like 3 (LOC111806112), mRNA. (976 bp)
db_xref="CDD:323741" ORIGIN // tttgttctactgctcaactcttgctcattcgacaaagcttccgcagattttcttcagaaatgaagaaccgcggggaggcagatggaagtatccggaaattaacagcggaggatgccttagaatttctcaagaatgtgaaggacgtcattggaaacgagacggaaaaatatgaagaatttcttcaactcatgaaggatttagcgtttcaaagaattgacattgtgggcgtcataacaggggtaaagcgtctattcagaggtcataatgacctgattttgggctttaatacttttttgccacaaagatatgcaatagcttgtcctcttgaggatgaaacgcctcctcgaaggaggcggcctcttaaacttggagacgctttggactatgtcagtgaggttaagagacggtttgaaggtgagttccatatattcaattcatttatgagaaatttgcatttgtacaaaagaggaaaaaagcctctaagtgagctccaccgggaggtttgtgtactgatgcaagaccacccagaccttgttgagggttttgctgattttcttccttgtccttca...
position 257
XM_023691470.1 - Cucurbita pepo subsp. pepo (vegetable marrow) - NCBI
PREDICTED: Paralichthys olivaceus uncharacterized LOC109628451 (LOC109628451), ncRNA. (846 bp)
aaaaataaagaattcaactaatgggggaaataattatattgttgatttatgtaatacattgttcaagttaaaactgcagggtttttcatctgtgctgacagcaactgtgagcagaggataaacaacaacctggaaaacctgtttgtcaattcatcataaatacatctgctccactcttatgaacttgaaattaccatcatgccttgagggactctctttaaatttggcacaatcgtttgctcggactcgcaaattaactgatcagaattcagtcatctaaggtcaaagtttcgaggtcataatgacctcatgatacaatatgtctggtgaagacattttctcagcaatgtcttgaaattctgtgactgcacaaaaaaacgtgctaattgtgacaaattatatttgataacttttattaaactcctttaaggtcttc
position 704
XR_002202652.1 - Paralichthys olivaceus (Japanese flounder) - NCBI
PREDICTED: Lingula anatina solute carrier family 35 member F4-like (LOC106179691), mRNA. (777 bp)
ORIGIN // atgggcggaaatacttcatcaggccgcaccatcccgaaggtcacggtgacctcggccgccagtgtggacaattccaccgtgtcagcgacccagctcaacaacagcgatatactgcagccatccagcgcggagaaacctaggaagattgtctgtggaatcatcaccaccataactctcgcggtaactttcgtgggatttacagttctggcgagaagaacgtttgtgttgtatacgacattccaggcaccgtttttcttgacctacttttgcagcatctggccaatcataatgttcccggtgtgcattgttgcgaaatggttgcgaacgagggggaagttgcccatttcttcttcttggagagaatataaagctgttttcagcgaacacgacacctaccgtcctctgagtatcatctgtaagtgtgttgccttcagcttcctgtgggttggaccatggtacatgtttatacgcgcgttaggcatgatctcggtgctggatgtggtcatcttatcggctacgtacccttgttttatgtatctgttctcatggacgctgctctgtaatacattcatagccttcaggatagtggc...
position 38
XM_013563420.1 - Lingula anatina - NCBI
PREDICTED: Cucurbita pepo subsp. pepo paired amphipathic helix protein Sin3-like 4 (LOC111787080), partial mRNA. (581 bp)
ttttttcttgagactccttcagttgtgagttctatagatcaccgtaatcaccagatctttatatttttctgtatgtcgccttgggaatgaagaactgtgcagagccagatggtgggaggtggcagtattcagaaactaacaacgaatgatgccctagaatatcttaagaatgtcaaggacatcttccgagacaagaaggaaacatatgaagattttcttgaagttatgaaagaattcaaggctcaaagaattgatactgccggtgtcatagcaagagtaaagcatctatttaaaggtcatcgtgacctgattttgggctttaatacttttttgcccaaaggatttgcaataacttgttctcctgaggatgaaacacctcctcaaaagaagaagcctgttcaatttgaagaagctatcaactttgtcggtaagattaaggtaattaaa
position 428
XM_023667227.1 - Cucurbita pepo subsp. pepo (vegetable marrow) - NCBI

Data Export:

下記より最大10000件まで検索結果を取得できます。

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/ja/iubboth%3aaggtcannrtgacct
lang : ja | div : | spe : | query_string : iubboth:aggtcannrtgacct | format : html | download :

0.000 | 0.000 | search_start;
0.155 | 0.155 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=((nt:aggtcaaaatgacct)%7C(nt:aggtcaatatgacct)%7C(nt:aggtcaagatgacct)%7C(nt:aggtcaacatgacct)%7C(nt:aggtcataatgacct)%7C(nt:aggtcattatgacct)%7C(nt:aggtcatgatgacct)%7C(nt:aggtcatcatgacct)%7C(nt:aggtcagaatgacct)%7C(nt:aggtcagtatgacct)%7C(nt:aggtcaggatgacct)%7C(nt:aggtcagcatgacct)%7C(nt:aggtcacaatgacct)%7C(nt:aggtcactatgacct)%7C(nt:aggtcacgatgacct)%7C(nt:aggtcaccatgacct)%7C(nt:aggtcaaagtgacct)%7C(nt:aggtcaatgtgacct)%7C(nt:aggtcaaggtgacct)%7C(nt:aggtcaacgtgacct)%7C(nt:aggtcatagtgacct)%7C(nt:aggtcattgtgacct)%7C(nt:aggtcatggtgacct)%7C(nt:aggtcatcgtgacct)%7C(nt:aggtcagagtgacct)%7C(nt:aggtcagtgtgacct)%7C(nt:aggtcagggtgacct)%7C(nt:aggtcagcgtgacct)%7C(nt:aggtcacagtgacct)%7C(nt:aggtcactgtgacct)%7C(nt:aggtcacggtgacct)%7C(nt:aggtcaccgtgacct)%7C(nt:aggtcataatgacct)%7C(nt:aggtcatattgacct)%7C(nt:aggtcatagtgacct)%7C(nt:aggtcatactgacct)%7C(nt:aggtcattatgacct)%7C(nt:aggtcattttgacct)%7C(nt:aggtcattgtgacct)%7C(nt:aggtcattctgacct)%7C(nt:aggtcatgatgacct)%7C(nt:aggtcatgttgacct)%7C(nt:aggtcatggtgacct)%7C(nt:aggtcatgctgacct)%7C(nt:aggtcatcatgacct)%7C(nt:aggtcatcttgacct)%7C(nt:aggtcatcgtgacct)%7C(nt:aggtcatcctgacct)%7C(nt:aggtcacaatgacct)%7C(nt:aggtcacattgacct)%7C(nt:aggtcacagtgacct)%7C(nt:aggtcacactgacct)%7C(nt:aggtcactatgacct)%7C(nt:aggtcactttgacct)%7C(nt:aggtcactgtgacct)%7C(nt:aggtcactctgacct)%7C(nt:aggtcacgatgacct)%7C(nt:aggtcacgttgacct)%7C(nt:aggtcacggtgacct)%7C(nt:aggtcacgctgacct)%7C(nt:aggtcaccatgacct)%7C(nt:aggtcaccttgacct)%7C(nt:aggtcaccgtgacct)%7C(nt:aggtcaccctgacct))?to=0&format=json
0.480 | 0.326 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=((nt:aggtcaaaatgacct)%7C(nt:aggtcaatatgacct)%7C(nt:aggtcaagatgacct)%7C(nt:aggtcaacatgacct)%7C(nt:aggtcataatgacct)%7C(nt:aggtcattatgacct)%7C(nt:aggtcatgatgacct)%7C(nt:aggtcatcatgacct)%7C(nt:aggtcagaatgacct)%7C(nt:aggtcagtatgacct)%7C(nt:aggtcaggatgacct)%7C(nt:aggtcagcatgacct)%7C(nt:aggtcacaatgacct)%7C(nt:aggtcactatgacct)%7C(nt:aggtcacgatgacct)%7C(nt:aggtcaccatgacct)%7C(nt:aggtcaaagtgacct)%7C(nt:aggtcaatgtgacct)%7C(nt:aggtcaaggtgacct)%7C(nt:aggtcaacgtgacct)%7C(nt:aggtcatagtgacct)%7C(nt:aggtcattgtgacct)%7C(nt:aggtcatggtgacct)%7C(nt:aggtcatcgtgacct)%7C(nt:aggtcagagtgacct)%7C(nt:aggtcagtgtgacct)%7C(nt:aggtcagggtgacct)%7C(nt:aggtcagcgtgacct)%7C(nt:aggtcacagtgacct)%7C(nt:aggtcactgtgacct)%7C(nt:aggtcacggtgacct)%7C(nt:aggtcaccgtgacct)%7C(nt:aggtcataatgacct)%7C(nt:aggtcatattgacct)%7C(nt:aggtcatagtgacct)%7C(nt:aggtcatactgacct)%7C(nt:aggtcattatgacct)%7C(nt:aggtcattttgacct)%7C(nt:aggtcattgtgacct)%7C(nt:aggtcattctgacct)%7C(nt:aggtcatgatgacct)%7C(nt:aggtcatgttgacct)%7C(nt:aggtcatggtgacct)%7C(nt:aggtcatgctgacct)%7C(nt:aggtcatcatgacct)%7C(nt:aggtcatcttgacct)%7C(nt:aggtcatcgtgacct)%7C(nt:aggtcatcctgacct)%7C(nt:aggtcacaatgacct)%7C(nt:aggtcacattgacct)%7C(nt:aggtcacagtgacct)%7C(nt:aggtcacactgacct)%7C(nt:aggtcactatgacct)%7C(nt:aggtcactttgacct)%7C(nt:aggtcactgtgacct)%7C(nt:aggtcactctgacct)%7C(nt:aggtcacgatgacct)%7C(nt:aggtcacgttgacct)%7C(nt:aggtcacggtgacct)%7C(nt:aggtcacgctgacct)%7C(nt:aggtcaccatgacct)%7C(nt:aggtcaccttgacct)%7C(nt:aggtcaccgtgacct)%7C(nt:aggtcaccctgacct))?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.540 | 0.060 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]