GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-04-12 01:11:17, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       NR_029610                110 bp    RNA     linear   PRI 17-NOV-2024
DEFINITION  Homo sapiens microRNA 34a (MIR34A), microRNA.
ACCESSION   NR_029610
VERSION     NR_029610.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 110)
  AUTHORS   Dasgupta,R., Becker,W. and Petzold,K.
  TITLE     Elucidating microRNA-34a organisation within human Argonaute-2 by
            dynamic nuclear polarisation-enhanced magic angle spinning NMR
  JOURNAL   Nucleic Acids Res 52 (19), 11995-12004 (2024)
   PUBMED   39228364
  REMARK    GeneRIF: Elucidating microRNA-34a organisation within human
            Argonaute-2 by dynamic nuclear polarisation-enhanced magic angle
            spinning NMR.
REFERENCE   2  (bases 1 to 110)
  AUTHORS   Acosta-Plasencia,M., Castellano,J.J., Diaz,T., He,Y., Marrades,R.M.
            and Navarro,A.
  TITLE     Discovering genes and microRNAs involved in human lung development
            unveils IGFBP3/miR-34a dynamics and their relevance for alveolar
            differentiation
  JOURNAL   Stem Cell Res Ther 15 (1), 263 (2024)
   PUBMED   39183355
  REMARK    GeneRIF: Discovering genes and microRNAs involved in human lung
            development unveils IGFBP3/miR-34a dynamics and their relevance for
            alveolar differentiation.
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 110)
  AUTHORS   He,F., Yu,J., Ma,S., Zhao,W., Wang,Q., He,H., Zhang,M., Wang,J. and
            Lu,Z.
  TITLE     MiR-34a promotes mitochondrial pathway of apoptosis in human
            salivary gland epithelial cells by activating NF-kappaB signaling
  JOURNAL   Arch Biochem Biophys 758, 110063 (2024)
   PUBMED   38880321
  REMARK    GeneRIF: MiR-34a promotes mitochondrial pathway of apoptosis in
            human salivary gland epithelial cells by activating NF-kappaB
            signaling.
REFERENCE   4  (bases 1 to 110)
  AUTHORS   Sun,Y., Zhang,C., Ma,Q., Yu,X., Gao,X., Zhang,H., Shi,Y., Li,Y. and
            He,X.
  TITLE     MiR-34a-HK1 signal axis retards bone marrow mesenchymal stem cell
            senescence via ameliorating glycolytic metabolism
  JOURNAL   Stem Cell Res Ther 15 (1), 238 (2024)
   PUBMED   39080798
  REMARK    GeneRIF: MiR-34a-HK1 signal axis retards bone marrow mesenchymal
            stem cell senescence via ameliorating glycolytic metabolism.
            Publication Status: Online-Only
REFERENCE   5  (bases 1 to 110)
  AUTHORS   Hermeking,H.
  TITLE     The miR-34 family in cancer and apoptosis
  JOURNAL   Cell Death Differ 17 (2), 193-199 (2010)
   PUBMED   19461653
  REMARK    GeneRIF: evidence for a role of miR-34a and miR-34b/c in the
            apoptotic response of normal and tumor cells
            Review article
REFERENCE   6  (bases 1 to 110)
  AUTHORS   Welch,C., Chen,Y. and Stallings,R.L.
  TITLE     MicroRNA-34a functions as a potential tumor suppressor by inducing
            apoptosis in neuroblastoma cells
  JOURNAL   Oncogene 26 (34), 5017-5022 (2007)
   PUBMED   17297439
  REMARK    GeneRIF: miR-34a directly targets the mRNA encoding E2F3 and
            significantly reduces the levels of E2F3 protein in neuroblastoma
            cells.
REFERENCE   7  (bases 1 to 110)
  AUTHORS   Raver-Shapira,N., Marciano,E., Meiri,E., Spector,Y., Rosenfeld,N.,
            Moskovits,N., Bentwich,Z. and Oren,M.
  TITLE     Transcriptional activation of miR-34a contributes to p53-mediated
            apoptosis
  JOURNAL   Mol Cell 26 (5), 731-743 (2007)
   PUBMED   17540598
REFERENCE   8  (bases 1 to 110)
  AUTHORS   Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and
            Enright,A.J.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
REFERENCE   9  (bases 1 to 110)
  AUTHORS   Lim,L.P., Glasner,M.E., Yekta,S., Burge,C.B. and Bartel,D.P.
  TITLE     Vertebrate microRNA genes
  JOURNAL   Science 299 (5612), 1540 (2003)
   PUBMED   12624257
REFERENCE   10 (bases 1 to 110)
  AUTHORS   Dostie,J., Mourelatos,Z., Yang,M., Sharma,A. and Dreyfuss,G.
  TITLE     Numerous microRNPs in neuronal cells containing novel microRNAs
  JOURNAL   RNA 9 (2), 180-186 (2003)
   PUBMED   12554860
  REMARK    Erratum:[RNA. 2003 May;9(5):631-2]
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AL591166.12.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. This miRNA is a member of the highly
            conserved miR-34 family. This miRNA functions as a tumor suppressor
            and dysregulation or loss of the host gene from which this miRNA is
            processed is associated with cancer progression in numerous cell
            types. [provided by RefSeq, Sep 2015].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript is intronless :: LM608342.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-110               AL591166.12        20546-20655         c
FEATURES             Location/Qualifiers
     source          1..110
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1p36.22"
     gene            1..110
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /note="microRNA 34a"
                     /db_xref="GeneID:407040"
                     /db_xref="HGNC:HGNC:31635"
                     /db_xref="MIM:611172"
                     /db_xref="miRBase:MI0000268"
     precursor_RNA   1..110
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /product="microRNA 34a"
                     /db_xref="GeneID:407040"
                     /db_xref="HGNC:HGNC:31635"
                     /db_xref="MIM:611172"
                     /db_xref="miRBase:MI0000268"
     exon            1..110
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372904298"
     variation       2
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:999624620"
     variation       3..4
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1639425387"
     variation       3
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780461995"
     variation       6
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1483864352"
     variation       7
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2521406798"
     variation       9..15
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /replace="gtg"
                     /replace="gtgagtg"
                     /db_xref="dbSNP:1208438106"
     variation       11..13
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /replace="g"
                     /replace="gag"
                     /db_xref="dbSNP:768855806"
     ncRNA           22..43
                     /ncRNA_class="miRNA"
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /product="hsa-miR-34a-5p"
                     /db_xref="miRBase:MIMAT0000255"
                     /db_xref="GeneID:407040"
                     /db_xref="HGNC:HGNC:31635"
                     /db_xref="MIM:611172"
                     /db_xref="miRBase:MI0000268"
     variation       22
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1639425241"
     variation       24
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756492579"
     variation       25
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1407488784"
     variation       26
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369892834"
     variation       34
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:750826817"
     variation       35
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:35301225"
     variation       36
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1230701086"
     variation       39
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768065817"
     variation       47
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2521406753"
     variation       49
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762439387"
     variation       51
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1639424828"
     variation       55
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72631823"
     variation       56..57
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1639424704"
     variation       59
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:574713255"
     variation       60
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1379763179"
     variation       63
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1039234683"
     ncRNA           64..85
                     /ncRNA_class="miRNA"
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /product="hsa-miR-34a-3p"
                     /db_xref="miRBase:MIMAT0004557"
                     /db_xref="GeneID:407040"
                     /db_xref="HGNC:HGNC:31635"
                     /db_xref="MIM:611172"
                     /db_xref="miRBase:MI0000268"
     variation       64
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1639424511"
     variation       65
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2521406716"
     variation       66
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1489276188"
     variation       69
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1357866392"
     variation       71
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:763206520"
     variation       80
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1639424340"
     variation       86
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1639424295"
     variation       87
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775644632"
     variation       90
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201359809"
     variation       91
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2521406673"
     variation       94
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1168775113"
     variation       98
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1639424124"
     variation       99
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:534804406"
     variation       102
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1639424022"
     variation       103
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1387857281"
     variation       103
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:763355454"
     variation       104
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1458052362"
     variation       107
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1174902187"
     variation       108
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1434793716"
     variation       109
                     /gene="MIR34A"
                     /gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2521406629"
ORIGIN      
ggccagctgtgagtgtttctttggcagtgtcttagctggttgttgtgagcaatagtaaggaagcaatcagcaagtatactgccctagaagtgctgcacgttgtggggccc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]