LOCUS       NR_029477                 72 bp    RNA     linear   PRI 03-SEP-2023
DEFINITION  Homo sapiens microRNA let-7a-2 (MIRLET7A2), microRNA.
ACCESSION   NR_029477
VERSION     NR_029477.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 72)
  AUTHORS   Dong Q, Qiu H, Piao C, Li Z and Cui X.
  TITLE     LncRNA SNHG4 promotes prostate cancer cell survival and resistance
            to enzalutamide through a let-7a/RREB1 positive feedback loop and a
            ceRNA network
  JOURNAL   J Exp Clin Cancer Res 42 (1), 209 (2023)
   PUBMED   37596700
  REMARK    GeneRIF: LncRNA SNHG4 promotes prostate cancer cell survival and
            resistance to enzalutamide through a let-7a/RREB1 positive feedback
            loop and a ceRNA network.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 72)
  AUTHORS   Liu X, Chen Z, Li S, Jin L, Cui X, Cui C, Deng Y, Gao Q, Fan L, Niu
            Y, Wang W, Cui C, Zhong J, Cui Q, Geng B and Cai J.
  TITLE     Pre-miRNA Hsa-Let-7a-2: a Novel Intracellular Partner of
            Angiotensin II Type 2 Receptor Negatively Regulating its Signals
  JOURNAL   Int J Biol Sci 18 (8), 3237-3250 (2022)
   PUBMED   35637969
  REMARK    GeneRIF: Pre-miRNA Hsa-Let-7a-2: a Novel Intracellular Partner of
            Angiotensin II Type 2 Receptor Negatively Regulating its Signals.
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 72)
  AUTHORS   Serej ZA, Ebrahimi A, Kazemi T, Najafi S, Amini M, Nastarin P,
            Baghbani E and Baradaran B.
  TITLE     NANOG gene suppression and replacement of let-7 modulate the
            stemness, invasion, and apoptosis in breast cancer
  JOURNAL   Gene 801, 145844 (2021)
   PUBMED   34274471
  REMARK    GeneRIF: NANOG gene suppression and replacement of let-7 modulate
            the stemness, invasion, and apoptosis in breast cancer.
REFERENCE   4  (bases 1 to 72)
  AUTHORS   Xie X, Du D, Guan Y, Jin T, Chen J, Wang Q, Li D, Xie Y, Liu N and
            Xie P.
  TITLE     Predictive Value of let-7a for Cancer Cell Repopulation between
            Chemotherapy and Long-Term Survival: A Prospective Study
  JOURNAL   Ann Clin Lab Sci 51 (5), 638-645 (2021)
   PUBMED   34686505
  REMARK    GeneRIF: Predictive Value of let-7a for Cancer Cell Repopulation
            between Chemotherapy and Long-Term Survival: A Prospective Study.
REFERENCE   5  (bases 1 to 72)
  AUTHORS   Liu H and Jiang B.
  TITLE     Let-7a-5p represses proliferation, migration, invasion and
            epithelial-mesenchymal transition by targeting Smad2 in
            TGF-b2-induced human lens epithelial cells
  JOURNAL   J Biosci 45 (2020)
   PUBMED   32345785
  REMARK    GeneRIF: Let-7a-5p represses proliferation, migration, invasion and
            epithelial-mesenchymal transition by targeting Smad2 in
            TGF-b2-induced human lens epithelial cells.
REFERENCE   6  (bases 1 to 72)
  AUTHORS   Kasashima K, Nakamura Y and Kozu T.
  TITLE     Altered expression profiles of microRNAs during TPA-induced
            differentiation of HL-60 cells
  JOURNAL   Biochem Biophys Res Commun 322 (2), 403-410 (2004)
   PUBMED   15325244
REFERENCE   7  (bases 1 to 72)
  AUTHORS   Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM,
            Yoon HS, Moon SY, Kim VN and Kim KS.
  TITLE     Human embryonic stem cells express a unique set of microRNAs
  JOURNAL   Dev Biol 270 (2), 488-498 (2004)
   PUBMED   15183728
REFERENCE   8  (bases 1 to 72)
  AUTHORS   Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP and
            James RJ.
  TITLE     Reduced accumulation of specific microRNAs in colorectal neoplasia
  JOURNAL   Mol Cancer Res 1 (12), 882-891 (2003)
   PUBMED   14573789
REFERENCE   9  (bases 1 to 72)
  AUTHORS   Dostie J, Mourelatos Z, Yang M, Sharma A and Dreyfuss G.
  TITLE     Numerous microRNPs in neuronal cells containing novel microRNAs
  JOURNAL   RNA 9 (2), 180-186 (2003)
   PUBMED   12554860
  REMARK    Erratum:[RNA. 2003 May;9(5):631-2]
REFERENCE   10 (bases 1 to 72)
  AUTHORS   Lagos-Quintana M, Rauhut R, Lendeckel W and Tuschl T.
  TITLE     Identification of novel genes coding for small expressed RNAs
  JOURNAL   Science 294 (5543), 853-858 (2001)
   PUBMED   11679670
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AP001359.4.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript is intronless :: LM608150.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-72                AP001359.4         114480-114551       c
FEATURES             Location/Qualifiers
     source          1..72
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="11"
                     /map="11q24.1"
     gene            1..72
                     /gene="MIRLET7A2"
                     /gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
                     /note="microRNA let-7a-2"
                     /db_xref="GeneID:406882"
                     /db_xref="HGNC:HGNC:31477"
                     /db_xref="MIM:612142"
                     /db_xref="miRBase:MI0000061"
     precursor_RNA   1..72
                     /gene="MIRLET7A2"
                     /gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
                     /product="microRNA let-7a-2"
                     /db_xref="GeneID:406882"
                     /db_xref="HGNC:HGNC:31477"
                     /db_xref="MIM:612142"
                     /db_xref="miRBase:MI0000061"
     exon            1..72
                     /gene="MIRLET7A2"
                     /gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="MIRLET7A2"
                     /gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1942706673"
     variation       2
                     /gene="MIRLET7A2"
                     /gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1023002595"
     ncRNA           5..26
                     /ncRNA_class="miRNA"
                     /gene="MIRLET7A2"
                     /gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
                     /product="hsa-let-7a-5p"
                     /db_xref="miRBase:MIMAT0000062"
                     /db_xref="GeneID:406882"
                     /db_xref="HGNC:HGNC:31477"
                     /db_xref="MIM:612142"
                     /db_xref="miRBase:MI0000061"
     variation       10
                     /gene="MIRLET7A2"
                     /gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1362975136"
     variation       19
                     /gene="MIRLET7A2"
                     /gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1176612700"
     variation       21
                     /gene="MIRLET7A2"
                     /gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760725471"
     variation       25
                     /gene="MIRLET7A2"
                     /gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770465876"
     variation       27
                     /gene="MIRLET7A2"
                     /gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370340749"
     polyA_site      28
                     /gene="MIRLET7A2"
                     /gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
                     /note="major polyA site"
     variation       31..32
                     /gene="MIRLET7A2"
                     /gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
                     /replace="at"
                     /replace="atat"
                     /db_xref="dbSNP:1942705719"
     variation       32
                     /gene="MIRLET7A2"
                     /gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1942705572"
     variation       35..36
                     /gene="MIRLET7A2"
                     /gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
                     /replace=""
                     /replace="tatatatacagtt"
                     /db_xref="dbSNP:778742532"
     variation       35
                     /gene="MIRLET7A2"
                     /gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1942705433"
     variation       37
                     /gene="MIRLET7A2"
                     /gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772905825"
     variation       38
                     /gene="MIRLET7A2"
                     /gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1285776542"
     variation       41
                     /gene="MIRLET7A2"
                     /gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1205331984"
     variation       42
                     /gene="MIRLET7A2"
                     /gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769568675"
     variation       44
                     /gene="MIRLET7A2"
                     /gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:561124326"
     ncRNA           50..71
                     /ncRNA_class="miRNA"
                     /gene="MIRLET7A2"
                     /gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
                     /product="hsa-let-7a-2-3p"
                     /db_xref="miRBase:MIMAT0010195"
                     /db_xref="GeneID:406882"
                     /db_xref="HGNC:HGNC:31477"
                     /db_xref="MIM:612142"
                     /db_xref="miRBase:MI0000061"
     variation       50
                     /gene="MIRLET7A2"
                     /gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2134641361"
     variation       59
                     /gene="MIRLET7A2"
                     /gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781140476"
ORIGIN      

aggttgaggtagtaggttgtatagtttagaattacatcaagggagataactgtacagcctcctagctttcct

//