2025-03-14 17:59:03, GGRNA.v2 : RefSeq release 228 (Jan, 2025)
LOCUS NM_001001877 1058 bp mRNA linear PRI 10-JUN-2024 DEFINITION Homo sapiens heat shock transcription factor Y-linked 2 (HSFY2), transcript variant 2, mRNA. ACCESSION NM_001001877 VERSION NM_001001877.2 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 1058) AUTHORS Haenig,C., Atias,N., Taylor,A.K., Mazza,A., Schaefer,M.H., Russ,J., Riechers,S.P., Jain,S., Coughlin,M., Fontaine,J.F., Freibaum,B.D., Brusendorf,L., Zenkner,M., Porras,P., Stroedicke,M., Schnoegl,S., Arnsburg,K., Boeddrich,A., Pigazzini,L., Heutink,P., Taylor,J.P., Kirstein,J., Andrade-Navarro,M.A., Sharan,R. and Wanker,E.E. TITLE Interactome Mapping Provides a Network of Neurodegenerative Disease Proteins and Uncovers Widespread Protein Aggregation in Affected Brains JOURNAL Cell Rep 32 (7), 108050 (2020) PUBMED 32814053 REFERENCE 2 (bases 1 to 1058) AUTHORS Luck,K., Kim,D.K., Lambourne,L., Spirohn,K., Begg,B.E., Bian,W., Brignall,R., Cafarelli,T., Campos-Laborie,F.J., Charloteaux,B., Choi,D., Cote,A.G., Daley,M., Deimling,S., Desbuleux,A., Dricot,A., Gebbia,M., Hardy,M.F., Kishore,N., Knapp,J.J., Kovacs,I.A., Lemmens,I., Mee,M.W., Mellor,J.C., Pollis,C., Pons,C., Richardson,A.D., Schlabach,S., Teeking,B., Yadav,A., Babor,M., Balcha,D., Basha,O., Bowman-Colin,C., Chin,S.F., Choi,S.G., Colabella,C., Coppin,G., D'Amata,C., De Ridder,D., De Rouck,S., Duran-Frigola,M., Ennajdaoui,H., Goebels,F., Goehring,L., Gopal,A., Haddad,G., Hatchi,E., Helmy,M., Jacob,Y., Kassa,Y., Landini,S., Li,R., van Lieshout,N., MacWilliams,A., Markey,D., Paulson,J.N., Rangarajan,S., Rasla,J., Rayhan,A., Rolland,T., San-Miguel,A., Shen,Y., Sheykhkarimli,D., Sheynkman,G.M., Simonovsky,E., Tasan,M., Tejeda,A., Tropepe,V., Twizere,J.C., Wang,Y., Weatheritt,R.J., Weile,J., Xia,Y., Yang,X., Yeger-Lotem,E., Zhong,Q., Aloy,P., Bader,G.D., De Las Rivas,J., Gaudet,S., Hao,T., Rak,J., Tavernier,J., Hill,D.E., Vidal,M., Roth,F.P. and Calderwood,M.A. TITLE A reference map of the human binary protein interactome JOURNAL Nature 580 (7803), 402-408 (2020) PUBMED 32296183 REFERENCE 3 (bases 1 to 1058) AUTHORS Fragoza,R., Das,J., Wierbowski,S.D., Liang,J., Tran,T.N., Liang,S., Beltran,J.F., Rivera-Erick,C.A., Ye,K., Wang,T.Y., Yao,L., Mort,M., Stenson,P.D., Cooper,D.N., Wei,X., Keinan,A., Schimenti,J.C., Clark,A.G. and Yu,H. TITLE Extensive disruption of protein interactions by genetic variants across the allele frequency spectrum in human populations JOURNAL Nat Commun 10 (1), 4141 (2019) PUBMED 31515488 REMARK Publication Status: Online-Only REFERENCE 4 (bases 1 to 1058) AUTHORS Chen,S., Fragoza,R., Klei,L., Liu,Y., Wang,J., Roeder,K., Devlin,B. and Yu,H. TITLE An interactome perturbation framework prioritizes damaging missense mutations for developmental disorders JOURNAL Nat Genet 50 (7), 1032-1040 (2018) PUBMED 29892012 REFERENCE 5 (bases 1 to 1058) AUTHORS Yin,Y., Morgunova,E., Jolma,A., Kaasinen,E., Sahu,B., Khund-Sayeed,S., Das,P.K., Kivioja,T., Dave,K., Zhong,F., Nitta,K.R., Taipale,M., Popov,A., Ginno,P.A., Domcke,S., Yan,J., Schubeler,D., Vinson,C. and Taipale,J. TITLE Impact of cytosine methylation on DNA binding specificities of human transcription factors JOURNAL Science 356 (6337) (2017) PUBMED 28473536 REFERENCE 6 (bases 1 to 1058) AUTHORS Corominas,R., Yang,X., Lin,G.N., Kang,S., Shen,Y., Ghamsari,L., Broly,M., Rodriguez,M., Tam,S., Wanamaker,S.A., Fan,C., Yi,S., Tasan,M., Lemmens,I., Kuang,X., Zhao,N., Malhotra,D., Michaelson,J.J., Vacic,V., Calderwood,M.A., Roth,F.P., Tavernier,J., Horvath,S., Salehi-Ashtiani,K., Korkin,D., Sebat,J., Hill,D.E., Hao,T., Vidal,M. and Iakoucheva,L.M. TITLE Protein interaction network of alternatively spliced isoforms from brain links genetic risk factors for autism JOURNAL Nat Commun 5, 3650 (2014) PUBMED 24722188 REMARK Erratum:[Nat Commun. 2023 Feb 2;14(1):569. doi: 10.1038/s41467-023-36264-y. PMID: 36732511] Publication Status: Online-Only REFERENCE 7 (bases 1 to 1058) AUTHORS Vaquerizas,J.M., Kummerfeld,S.K., Teichmann,S.A. and Luscombe,N.M. TITLE A census of human transcription factors: function, expression and evolution JOURNAL Nat Rev Genet 10 (4), 252-263 (2009) PUBMED 19274049 REMARK Review article REFERENCE 8 (bases 1 to 1058) AUTHORS Shinka,T., Sato,Y., Chen,G., Naroda,T., Kinoshita,K., Unemi,Y., Tsuji,K., Toida,K., Iwamoto,T. and Nakahori,Y. TITLE Molecular characterization of heat shock-like factor encoded on the human Y chromosome, and implications for male infertility JOURNAL Biol Reprod 71 (1), 297-306 (2004) PUBMED 15044259 REFERENCE 9 (bases 1 to 1058) AUTHORS Tessari,A., Salata,E., Ferlin,A., Bartoloni,L., Slongo,M.L. and Foresta,C. TITLE Characterization of HSFY, a novel AZFb gene on the Y chromosome with a possible role in human spermatogenesis JOURNAL Mol Hum Reprod 10 (4), 253-258 (2004) PUBMED 14985478 REMARK GeneRIF: Could have an important role in human spermatogenesis. REFERENCE 10 (bases 1 to 1058) AUTHORS Skaletsky,H., Kuroda-Kawaguchi,T., Minx,P.J., Cordum,H.S., Hillier,L., Brown,L.G., Repping,S., Pyntikova,T., Ali,J., Bieri,T., Chinwalla,A., Delehaunty,A., Delehaunty,K., Du,H., Fewell,G., Fulton,L., Fulton,R., Graves,T., Hou,S.F., Latrielle,P., Leonard,S., Mardis,E., Maupin,R., McPherson,J., Miner,T., Nash,W., Nguyen,C., Ozersky,P., Pepin,K., Rock,S., Rohlfing,T., Scott,K., Schultz,B., Strong,C., Tin-Wollam,A., Yang,S.P., Waterston,R.H., Wilson,R.K., Rozen,S. and Page,D.C. TITLE The male-specific region of the human Y chromosome is a mosaic of discrete sequence classes JOURNAL Nature 423 (6942), 825-837 (2003) PUBMED 12815422 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AC007379.2. On Aug 13, 2020 this sequence version replaced NM_001001877.1. Summary: This gene encodes a member of the heat shock factor (HSF) family of transcriptional activators for heat shock proteins. This gene is a candidate gene for azoospermia, since it localizes to a region of chromosome Y that is sometimes deleted in infertile males. The genome has two identical copies of this gene within a palindromic region; this record represents the more telomeric copy. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (2) includes a different exon in the 3' coding region, resulting in a frameshift and earlier termination codon, compared to variant 1. The resulting isoform (2) is shorter and has a distinct C-terminus compared to isoform 1. Isoform 2 lacks the HFS-type DNA-binding domain found in isoform 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AI798750.1, AI221709.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1968968, SAMEA2151119 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-20 AC007379.2 104620-104639 c 21-630 AC007379.2 104010-104619 c 631-1058 AC007379.2 62344-62771 c FEATURES Location/Qualifiers source 1..1058 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="Y" /map="Yq11.222" gene 1..1058 /gene="HSFY2" /gene_synonym="HSF2L; HSFY" /note="heat shock transcription factor Y-linked 2" /db_xref="GeneID:159119" /db_xref="HGNC:HGNC:23950" exon 1..630 /gene="HSFY2" /gene_synonym="HSF2L; HSFY" /inference="alignment:Splign:2.1.0" misc_feature 94..96 /gene="HSFY2" /gene_synonym="HSF2L; HSFY" /note="upstream in-frame stop codon" CDS 118..729 /gene="HSFY2" /gene_synonym="HSF2L; HSFY" /note="isoform 2 is encoded by transcript variant 2; heat shock transcription factor 2-like protein" /codon_start=1 /product="heat shock transcription factor, Y-linked isoform 2" /protein_id="NP_001001877.1" /db_xref="CCDS:CCDS35476.1" /db_xref="GeneID:159119" /db_xref="HGNC:HGNC:23950" /translation="
MAHVSSETQDVSPKDELTASEASTRSPLCEHTFPGDSDLRSMIEEHAFQVLSQGSLLESPSYTVCVSEPDKDDDFLSLNFPRKLWKIVESDQFKSISWDENGTCIVINEELFKKEILETKAPYRIFQTDAIKSFVRQLNLYGFSKIQQNFQRSAFLATFLSEEKESSVLSKIRFTKMKLSRSSTYENRYLCCNLHLKDESNYS"
misc_feature 118..207 /gene="HSFY2" /gene_synonym="HSF2L; HSFY" /note="propagated from UniProtKB/Swiss-Prot (Q96LI6.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 355..>576 /gene="HSFY2" /gene_synonym="HSF2L; HSFY" /note="HSF-type DNA-binding; Region: HSF_DNA-bind; pfam00447" /db_xref="CDD:459813" variation 425 /gene="HSFY2" /gene_synonym="HSF2L; HSFY" /replace="c" /replace="t" /db_xref="dbSNP:2520889123" exon 631..1058 /gene="HSFY2" /gene_synonym="HSF2L; HSFY" /inference="alignment:Splign:2.1.0" variation 920..929 /gene="HSFY2" /gene_synonym="HSF2L; HSFY" /replace="tttttttt" /replace="ttttttttt" /replace="tttttttttt" /db_xref="dbSNP:2520887345" ORIGIN
aaccattgtgatggtctagataagtgtacatgcttaggccttctgaagcagcatttgaagctgcagtcctgaaaaccatgcaggccggaagagtagataaagaaatatttatttgagatggcacatgtttcttcagaaactcaagatgtttcccccaaagatgaattaactgcttcagaagcctccactaggtctccattgtgtgaacacaccttccctggggactcagacttacggtcaatgattgaagaacatgcttttcaggttttgtcacaaggatccttgttagaaagtccaagttacacagtttgtgtctctgagccagataaagatgatgattttctttctctgaactttcccaggaaactttggaaaatagtggaaagtgaccaattcaagtctatttcatgggatgagaatggaacttgcatagtgattaatgaagaactcttcaagaaagaaattttggaaacaaaggctccttacagaatatttcaaactgatgctatcaaaagttttgttcgacagctcaacctttatggatttagtaaaattcaacagaattttcaaagatctgcctttctagccacctttctgtcagaagagaaagaatcgtctgtcttaagcaagatacgcttcaccaaaatgaaactttccagatcttcaacttatgaaaacaggtatttatgttgcaacttacatttaaaagatgagtcgaattactcataatccttagaagttagcttgtccgcatctgaaaattcacttttaccttgaagttcaatctgtctctgggaaagactagattggaagaataaaattcaagaatgtgatgttttagtaatggaaaagccaagagcgtcaggtggcaaaagtccttctgttactcaagaaaatgctctgaaaaattccttttctcttttttttttgtaaagattaactccacctcaccaccacaatgaggtatttttctcagcaattgacacctgtttactcagttactccctgtaactatgttatgctgtgaagtaggcaatacagttgttaaagaagaataa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]