GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-10-31 07:47:22, GGRNA.v2 : RefSeq release 232 (Sep, 2025)

LOCUS       XM_046929089            2517 bp    mRNA    linear   VRT 01-MAR-2022
DEFINITION  PREDICTED: Gallus gallus DEAD-box helicase 31 (DDX31), transcript
            variant X6, mRNA.
ACCESSION   XM_046929089
VERSION     XM_046929089.1
DBLINK      BioProject: PRJNA698614
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_052589.1) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Gallus gallus Annotation Release 106
            Annotation Version          :: 106
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 9.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2517
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /isolate="bGalGal1"
                     /db_xref="taxon:9031"
                     /chromosome="17"
                     /sex="female"
                     /tissue_type="blood"
                     /geo_loc_name="USA: Fayetteville"
                     /lat_lon="36.0822 N 94.1719 W"
                     /collection_date="20-May-2019"
                     /collected_by="Nick Anthony"
     gene            1..2517
                     /gene="DDX31"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 15 mRNAs, 7 ESTs, 77 long SRA
                     reads, 1 Protein, and 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 42 samples
                     with support for all annotated introns"
                     /db_xref="CGNC:2579"
                     /db_xref="GeneID:427759"
     misc_feature    1
                     /gene="DDX31"
                     /experiment="COORDINATES: cap analysis [ECO:0007248]"
                     /note="transcription start site"
     CDS             511..2199
                     /gene="DDX31"
                     /codon_start=1
                     /product="probable ATP-dependent RNA helicase DDX31
                     isoform X7"
                     /protein_id="XP_046785045.1"
                     /db_xref="GeneID:427759"
                     /db_xref="CGNC:2579"
                     /translation="
MTSVQKQTIPVLLQGKDALVRSQTGSGKTLAYGIPLVQSLQGMQSKIQRSDGPYALVLVPTRELALQTFDTIQKLLKPFTWIVPGVLMGGEKRKSEKARLRKGINILISTPGRLVDHIKSTECIHFRRTQWLIIDEADRILDLGFEKDVTVILNALNAERETRQNVLLSATLTEGVTRLADISLNDPIRISIADEIRESLKPALQTEKEANSSSNRMDQENFAVPEKLKQYFMMVPSKLRLVTLAAFVLEKCKYEKQHKMIIFFSSCEQVEFHYELLVNVLSGELESEQPKRSSVSSVQLQFLRLHGNMEQEERTEVFQEFLKSKTGILLCTDVAARGLDLPQVTWIVQYNAPASPAEYIHRIGRTARIGCHGNSLLVLAPSEAEYVSLLASHKINVSEIKMEKVLSSLMKDDRFRLRRPGSKKSYGVDPQEVRERATVLQTQFENYVHSSEGTIRWAKKALQSFLCAYTAYPRSLKHIFHIKSIHLGHVAKSFGLRDAPQNLTTLPTANSKKKTKPRAKRSDLLKKTHGKHRLAEILRSEYSSGMDTGVSKVKKKKKKKTD"
     misc_feature    511..1818
                     /gene="DDX31"
                     /note="Superfamily II DNA and RNA helicase [Replication,
                     recombination and repair]; Region: SrmB; COG0513"
                     /db_xref="CDD:440279"
     misc_feature    511..1083
                     /gene="DDX31"
                     /note="DEAD-box helicase domain of DEAD box protein 31;
                     Region: DEADc_DDX31; cd17949"
                     /db_xref="CDD:350707"
     misc_feature    1831..2013
                     /gene="DDX31"
                     /note="Domain of unknown function (DUF4217); Region:
                     DUF4217; pfam13959"
                     /db_xref="CDD:464056"
     polyA_site      2517
                     /gene="DDX31"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      
gggctgcgggctgcgcttcggcctgggcgcctgagggggcttttccagccgcagcggctctggttcccgtgggtacattgaggcagagcaactccgctgtgagcgttctgagccgccgcggatggaaggactgggttttgttcgcctaatgctctgaaaagaaagctccagtcgtcaccacatggaaacccacctctgaaacgtaaacctaagccatcagtaaacaacttcaagaaacgtgttgcagagactggcaccagggaaaagggaagatcatcaaaaaggtctcttcctaagaagcaactgaatgccaaccaaaatgaaagccagaaaagcaaacttttcattaagacatccagcctgtttagaaacaaccctgatatcccagaaattcacagaaaagcagtgcagcaggtgcaggaaaatgttttcactacagactctttcagccagttggacctccatccacacctgatagccacaataactacagttctgaagatatgtagtatgaccagtgttcagaagcaaacaattcctgtgctcctgcaaggcaaagatgctctggtgagatctcagactggttcaggtaaaactcttgcctatggaattccacttgtacagtccttgcaaggaatgcaatccaaaatacagcgaagtgacgggccttatgcactggtgttagtcccaacaagagagcttgcactccagacttttgatacaatacagaagctactcaagccatttacctggattgttcctggagtgcttatggggggagaaaagagaaaatcagaaaaagccagattacggaaggggataaatatccttatttcaactcctggtcgcctggttgatcacatcaagtccacggaatgtattcatttccgtcgcactcagtggctgatcattgatgaagcagacaggatcctagacctgggctttgagaaggatgtaactgtgatacttaatgctttaaatgctgagagggagacgcgtcagaatgttctgctctcagccacactcactgaaggagtaacacggctggctgatatcagtttgaacgatcccatcagaatttccatagcagatgaaatccgggagagtctcaaaccagcattacaaacagaaaaagaagccaatagttcctcaaaccgtatggaccaggaaaactttgctgttccagagaagcttaagcagtatttcatgatggtccccagcaaattgaggcttgtcacattagcagcttttgtcctagagaaatgcaagtatgaaaagcaacataagatgatcatctttttctccagttgtgaacaagtggaattccactacgagctccttgttaatgtcctttcaggagagctagagtctgaacaacctaaacgttcatctgtctcctctgtgcaattacagtttctacgactgcatgggaacatggaacaggaagaaagaacagaggtcttccaggagttcctaaaatccaaaaccggcatcttactttgcactgatgtcgcagcacgtggactagacctgcctcaagtcacgtggattgtgcagtataacgctccagcttcacctgcggaatacatccaccggatcgggaggacggctcggattggctgtcacgggaacagcctgcttgtcctggcgccttcggaggcagaatatgtcagcttgctggcttctcacaagattaatgtctccgagataaagatggagaaggtactatccagcctgatgaaagacgatcgcttcaggctgcgcagaccaggaagcaagaaatcctatggcgtggaccctcaggaagtccgggagcgggccaccgtcctgcagacacaatttgagaattatgttcactccagtgaggggaccatccggtgggcaaaaaaagcactgcagtcttttctttgtgcctacaccgcctatcccagaagcctcaagcacatcttccacatcaaatctatccacctgggtcatgtggccaagagctttggcctgagagatgctccccagaacctgactactcttccaactgctaactcaaagaagaaaaccaaaccaagagcaaaaaggtctgaccttctcaagaagacccatggcaaacatcgcctggctgagatcttgcgatctgaatattccagtgggatggacactggtgtatccaaggtcaagaagaagaagaagaaaaaaacagactaaaactggcaaccagcagatcccagtatgagccaggacctcccagtcatttgctgcacaacctgctggagtacgtcagccagaggtcagggtgacctgccagactgactgacgagtggctcagtttgtcaggcaaaaatggggagggctcttggagatgctgacctcctccctcttatcccatagttccaaatggaattgaatccagacgtgtcctgttgcactgctgcaattatatgtggcttcctgaagatgcagcttgtttctaaggtgatattttgtgagaaaaataaaagagtttaattacggttttctgagaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]