2025-07-03 11:47:58, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS XM_046929089 2517 bp mRNA linear VRT 01-MAR-2022 DEFINITION PREDICTED: Gallus gallus DEAD-box helicase 31 (DDX31), transcript variant X6, mRNA. ACCESSION XM_046929089 VERSION XM_046929089.1 DBLINK BioProject: PRJNA698614 KEYWORDS RefSeq. SOURCE Gallus gallus (chicken) ORGANISM Gallus gallus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes; Phasianidae; Phasianinae; Gallus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_052589.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Gallus gallus Annotation Release 106 Annotation Version :: 106 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 9.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2517 /organism="Gallus gallus" /mol_type="mRNA" /isolate="bGalGal1" /db_xref="taxon:9031" /chromosome="17" /sex="female" /tissue_type="blood" /geo_loc_name="USA: Fayetteville" /lat_lon="36.0822 N 94.1719 W" /collection_date="20-May-2019" /collected_by="Nick Anthony" gene 1..2517 /gene="DDX31" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 15 mRNAs, 7 ESTs, 77 long SRA reads, 1 Protein, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 42 samples with support for all annotated introns" /db_xref="CGNC:2579" /db_xref="GeneID:427759" misc_feature 1 /gene="DDX31" /experiment="COORDINATES: cap analysis [ECO:0007248]" /note="transcription start site" CDS 511..2199 /gene="DDX31" /codon_start=1 /product="probable ATP-dependent RNA helicase DDX31 isoform X7" /protein_id="XP_046785045.1" /db_xref="GeneID:427759" /db_xref="CGNC:2579" /translation="
MTSVQKQTIPVLLQGKDALVRSQTGSGKTLAYGIPLVQSLQGMQSKIQRSDGPYALVLVPTRELALQTFDTIQKLLKPFTWIVPGVLMGGEKRKSEKARLRKGINILISTPGRLVDHIKSTECIHFRRTQWLIIDEADRILDLGFEKDVTVILNALNAERETRQNVLLSATLTEGVTRLADISLNDPIRISIADEIRESLKPALQTEKEANSSSNRMDQENFAVPEKLKQYFMMVPSKLRLVTLAAFVLEKCKYEKQHKMIIFFSSCEQVEFHYELLVNVLSGELESEQPKRSSVSSVQLQFLRLHGNMEQEERTEVFQEFLKSKTGILLCTDVAARGLDLPQVTWIVQYNAPASPAEYIHRIGRTARIGCHGNSLLVLAPSEAEYVSLLASHKINVSEIKMEKVLSSLMKDDRFRLRRPGSKKSYGVDPQEVRERATVLQTQFENYVHSSEGTIRWAKKALQSFLCAYTAYPRSLKHIFHIKSIHLGHVAKSFGLRDAPQNLTTLPTANSKKKTKPRAKRSDLLKKTHGKHRLAEILRSEYSSGMDTGVSKVKKKKKKKTD"
misc_feature 511..1818 /gene="DDX31" /note="Superfamily II DNA and RNA helicase [Replication, recombination and repair]; Region: SrmB; COG0513" /db_xref="CDD:440279" misc_feature 511..1083 /gene="DDX31" /note="DEAD-box helicase domain of DEAD box protein 31; Region: DEADc_DDX31; cd17949" /db_xref="CDD:350707" misc_feature 1831..2013 /gene="DDX31" /note="Domain of unknown function (DUF4217); Region: DUF4217; pfam13959" /db_xref="CDD:464056" polyA_site 2517 /gene="DDX31" /experiment="COORDINATES: polyA evidence [ECO:0006239]" ORIGIN
gggctgcgggctgcgcttcggcctgggcgcctgagggggcttttccagccgcagcggctctggttcccgtgggtacattgaggcagagcaactccgctgtgagcgttctgagccgccgcggatggaaggactgggttttgttcgcctaatgctctgaaaagaaagctccagtcgtcaccacatggaaacccacctctgaaacgtaaacctaagccatcagtaaacaacttcaagaaacgtgttgcagagactggcaccagggaaaagggaagatcatcaaaaaggtctcttcctaagaagcaactgaatgccaaccaaaatgaaagccagaaaagcaaacttttcattaagacatccagcctgtttagaaacaaccctgatatcccagaaattcacagaaaagcagtgcagcaggtgcaggaaaatgttttcactacagactctttcagccagttggacctccatccacacctgatagccacaataactacagttctgaagatatgtagtatgaccagtgttcagaagcaaacaattcctgtgctcctgcaaggcaaagatgctctggtgagatctcagactggttcaggtaaaactcttgcctatggaattccacttgtacagtccttgcaaggaatgcaatccaaaatacagcgaagtgacgggccttatgcactggtgttagtcccaacaagagagcttgcactccagacttttgatacaatacagaagctactcaagccatttacctggattgttcctggagtgcttatggggggagaaaagagaaaatcagaaaaagccagattacggaaggggataaatatccttatttcaactcctggtcgcctggttgatcacatcaagtccacggaatgtattcatttccgtcgcactcagtggctgatcattgatgaagcagacaggatcctagacctgggctttgagaaggatgtaactgtgatacttaatgctttaaatgctgagagggagacgcgtcagaatgttctgctctcagccacactcactgaaggagtaacacggctggctgatatcagtttgaacgatcccatcagaatttccatagcagatgaaatccgggagagtctcaaaccagcattacaaacagaaaaagaagccaatagttcctcaaaccgtatggaccaggaaaactttgctgttccagagaagcttaagcagtatttcatgatggtccccagcaaattgaggcttgtcacattagcagcttttgtcctagagaaatgcaagtatgaaaagcaacataagatgatcatctttttctccagttgtgaacaagtggaattccactacgagctccttgttaatgtcctttcaggagagctagagtctgaacaacctaaacgttcatctgtctcctctgtgcaattacagtttctacgactgcatgggaacatggaacaggaagaaagaacagaggtcttccaggagttcctaaaatccaaaaccggcatcttactttgcactgatgtcgcagcacgtggactagacctgcctcaagtcacgtggattgtgcagtataacgctccagcttcacctgcggaatacatccaccggatcgggaggacggctcggattggctgtcacgggaacagcctgcttgtcctggcgccttcggaggcagaatatgtcagcttgctggcttctcacaagattaatgtctccgagataaagatggagaaggtactatccagcctgatgaaagacgatcgcttcaggctgcgcagaccaggaagcaagaaatcctatggcgtggaccctcaggaagtccgggagcgggccaccgtcctgcagacacaatttgagaattatgttcactccagtgaggggaccatccggtgggcaaaaaaagcactgcagtcttttctttgtgcctacaccgcctatcccagaagcctcaagcacatcttccacatcaaatctatccacctgggtcatgtggccaagagctttggcctgagagatgctccccagaacctgactactcttccaactgctaactcaaagaagaaaaccaaaccaagagcaaaaaggtctgaccttctcaagaagacccatggcaaacatcgcctggctgagatcttgcgatctgaatattccagtgggatggacactggtgtatccaaggtcaagaagaagaagaagaaaaaaacagactaaaactggcaaccagcagatcccagtatgagccaggacctcccagtcatttgctgcacaacctgctggagtacgtcagccagaggtcagggtgacctgccagactgactgacgagtggctcagtttgtcaggcaaaaatggggagggctcttggagatgctgacctcctccctcttatcccatagttccaaatggaattgaatccagacgtgtcctgttgcactgctgcaattatatgtggcttcctgaagatgcagcttgtttctaaggtgatattttgtgagaaaaataaaagagtttaattacggttttctgagaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]