GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-07-01 22:01:04, GGRNA.v2 : RefSeq release 224 (May, 2024)

LOCUS       NM_205447               1412 bp    mRNA    linear   VRT 01-FEB-2024
DEFINITION  Gallus gallus thyroid hormone receptor beta (THRB), transcript
            variant 1, mRNA.
ACCESSION   NM_205447
VERSION     NM_205447.2
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
REFERENCE   1  (bases 1 to 1412)
  AUTHORS   Tang,H., Finn,R.D. and Thomas,P.D.
  TITLE     TreeGrafter: phylogenetic tree-based annotation of proteins with
            Gene Ontology terms and other annotations
  JOURNAL   Bioinformatics 35 (3), 518-520 (2019)
   PUBMED   30032202
REFERENCE   2  (bases 1 to 1412)
  AUTHORS   Burge,S., Kelly,E., Lonsdale,D., Mutowo-Muellenet,P., McAnulla,C.,
            Mitchell,A., Sangrador-Vegas,A., Yong,S.Y., Mulder,N. and Hunter,S.
  TITLE     Manual GO annotation of predictive protein signatures: the InterPro
            approach to GO curation
  JOURNAL   Database (Oxford) 2012, bar068 (2012)
   PUBMED   22301074
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1412)
  AUTHORS   Lassova,L., Niu,Z., Golden,E.B., Cohen,A.J. and Adams,S.L.
  TITLE     Thyroid hormone treatment of cultured chondrocytes mimics in vivo
            stimulation of collagen X mRNA by increasing BMP 4 expression
  JOURNAL   J Cell Physiol 219 (3), 595-605 (2009)
   PUBMED   19170125
REFERENCE   4  (bases 1 to 1412)
  AUTHORS   Grommen,S.V., Arckens,L., Theuwissen,T., Darras,V.M. and De
            Groef,B.
  TITLE     Thyroid hormone receptor beta2 is strongly up-regulated at all
            levels of the hypothalamo-pituitary-thyroidal axis during late
            embryogenesis in chicken
  JOURNAL   J Endocrinol 196 (3), 519-528 (2008)
   PUBMED   18310447
  REMARK    GeneRIF: changes occur in thyroid hormone (TH) receptor beta2
            (TRbeta2) expression at the different levels of the
            hypothalamo-pituitary-thyroidal (HPT) axis during the last week of
            chicken embryonic development and hatching
REFERENCE   5  (bases 1 to 1412)
  AUTHORS   Cho,Y.S., Kim,E.J., Park,U.H., Sin,H.S. and Um,S.J.
  TITLE     Additional sex comb-like 1 (ASXL1), in cooperation with SRC-1, acts
            as a ligand-dependent coactivator for retinoic acid receptor
  JOURNAL   J Biol Chem 281 (26), 17588-17598 (2006)
   PUBMED   16606617
REFERENCE   6  (bases 1 to 1412)
  AUTHORS   Boardman,P.E., Sanz-Ezquerro,J., Overton,I.M., Burt,D.W., Bosch,E.,
            Fong,W.T., Tickle,C., Brown,W.R., Wilson,S.A. and Hubbard,S.J.
  TITLE     A comprehensive collection of chicken cDNAs
  JOURNAL   Curr Biol 12 (22), 1965-1969 (2002)
   PUBMED   12445392
REFERENCE   7  (bases 1 to 1412)
  AUTHORS   Lachuer,J., Legras,C., Ronfort,C., Barges,S., Cohen-Adad,F.,
            Quivet,L., Duchamp,C., Verdier,G. and Barre,H.
  TITLE     Molecular cloning and sequencing of a cDNA encoding a beta-thyroid
            hormone receptor in muscovy duckling
  JOURNAL   Biochim Biophys Acta 1310 (1), 127-130 (1996)
   PUBMED   9244185
REFERENCE   8  (bases 1 to 1412)
  AUTHORS   Sjoberg,M., Vennstrom,B. and Forrest,D.
  TITLE     Thyroid hormone receptors in chick retinal development:
            differential expression of mRNAs for alpha and N-terminal variant
            beta receptors
  JOURNAL   Development 114 (1), 39-47 (1992)
   PUBMED   1576965
REFERENCE   9  (bases 1 to 1412)
  AUTHORS   Showers,M.O., Darling,D.S., Kieffer,G.D. and Chin,W.W.
  TITLE     Isolation and characterization of a cDNA encoding a chicken beta
            thyroid hormone receptor
  JOURNAL   DNA Cell Biol 10 (3), 211-221 (1991)
   PUBMED   1707280
REFERENCE   10 (bases 1 to 1412)
  AUTHORS   Forrest,D., Sjoberg,M. and Vennstrom,B.
  TITLE     Contrasting developmental and tissue-specific expression of alpha
            and beta thyroid hormone receptor genes
  JOURNAL   EMBO J 9 (5), 1519-1528 (1990)
   PUBMED   1970296
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            X17504.1 and Z50188.1.
            
            On Oct 25, 2013 this sequence version replaced NM_205447.1.
            
            Transcript Variant: This variant (1) represents the shorter
            transcript and encodes the shorter protein (isoform 1).
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: X17504.1, Z50188.1 [ECO:0000332]
            RNAseq introns              :: mixed sample support SAMEA103992290,
                                           SAMEA103992323 [ECO:0006172]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-22                X17504.1           24-45
            23-1193             Z50188.1           1-1171
            1194-1412           X17504.1           1217-1435
FEATURES             Location/Qualifiers
     source          1..1412
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /db_xref="taxon:9031"
                     /chromosome="2"
                     /map="2"
                     /breed="SPAFAS"
     gene            1..1412
                     /gene="THRB"
                     /gene_synonym="CTR BETA 2; NR1A2; TR-BETA"
                     /note="thyroid hormone receptor beta"
                     /db_xref="CGNC:49800"
                     /db_xref="GeneID:396431"
     exon            1..65
                     /gene="THRB"
                     /gene_synonym="CTR BETA 2; NR1A2; TR-BETA"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    11..13
                     /gene="THRB"
                     /gene_synonym="CTR BETA 2; NR1A2; TR-BETA"
                     /note="upstream in-frame stop codon"
     CDS             59..1168
                     /gene="THRB"
                     /gene_synonym="CTR BETA 2; NR1A2; TR-BETA"
                     /note="isoform 1 is encoded by transcript variant 1;
                     beta-thyroid hormone receptor; nuclear receptor subfamily
                     1 group A member 2; thyroid hormone receptor beta 2;
                     thyroid hormone receptor, beta (erythroblastic leukemia
                     viral (v-erb-a) oncogene homolog 2, avian); C-ERBA-BETA"
                     /codon_start=1
                     /product="thyroid hormone receptor beta isoform 1"
                     /protein_id="NP_990778.2"
                     /db_xref="CGNC:49800"
                     /db_xref="GeneID:396431"
                     /translation="
MSGYIPSYLDKDELCVVCGDKATGYHYRCITCEGCKGFFRRTIQKNLHPTYSCKYEGKCVIDKVTRNQCQECRFKKCIFVGMATDLVLDDSKRLAKRKLIEENREKRRREELQKTIGHKPEPTDEEWELIKIVTEAHVATNAQGSHWKQKRKFLPEDIGQAPIVNAPEGGKVDLEAFSQFTKIITPAITRVVDFAKKLPMFCELPCEDQIILLKGCCMEIMSLRAAVRYDPESETLTLNGEMAVTRGQLKNGGLGVVSDAIFDLGMSLSSFNLDDTEVALLQAVLLMSSDRPGLVCVERIEKCQEGFLLAFEHYINYRKHHVAHFWPKLLMKVTDLRMIGACHASRFLHMKVECPTELFPPLFLEVFED"
     misc_feature    59..100
                     /gene="THRB"
                     /gene_synonym="CTR BETA 2; NR1A2; TR-BETA"
                     /note="propagated from UniProtKB/Swiss-Prot (P68306.1);
                     Region: Modulating. /evidence=ECO:0000255"
     misc_feature    98..358
                     /gene="THRB"
                     /gene_synonym="CTR BETA 2; NR1A2; TR-BETA"
                     /note="DNA-binding domain of thyroid hormone receptors
                     (TRs) is composed of two C4-type zinc fingers; Region:
                     NR_DBD_TR; cd06961"
                     /db_xref="CDD:143519"
     misc_feature    order(101..103,110..112,152..154,161..163,215..217,
                     233..235,263..265,272..274)
                     /gene="THRB"
                     /gene_synonym="CTR BETA 2; NR1A2; TR-BETA"
                     /note="zinc binding site [ion binding]; other site"
                     /db_xref="CDD:143519"
     misc_feature    order(131..139,155..160,164..166,170..172,176..181,
                     188..190,254..259,266..268,275..277,314..322,335..337,
                     344..349,353..358)
                     /gene="THRB"
                     /gene_synonym="CTR BETA 2; NR1A2; TR-BETA"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:143519"
     misc_feature    order(131..133,140..142,305..307,311..316)
                     /gene="THRB"
                     /gene_synonym="CTR BETA 2; NR1A2; TR-BETA"
                     /note="heterodimer interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:143519"
     misc_feature    428..1156
                     /gene="THRB"
                     /gene_synonym="CTR BETA 2; NR1A2; TR-BETA"
                     /note="The ligand binding domain of thyroid hormone
                     receptor, a members of a superfamily of nuclear receptors;
                     Region: NR_LBD_TR; cd06935"
                     /db_xref="CDD:132733"
     misc_feature    order(587..589,596..601,605..610,617..619,626..628,
                     710..712,719..721,731..733,767..775,803..805,812..814,
                     818..820,839..841,1085..1087,1106..1108,1145..1147)
                     /gene="THRB"
                     /gene_synonym="CTR BETA 2; NR1A2; TR-BETA"
                     /note="ligand binding site [chemical binding]; other site"
                     /db_xref="CDD:132733"
     misc_feature    order(623..625,632..634,644..646,674..676,686..688,
                     695..697,1139..1144,1151..1153)
                     /gene="THRB"
                     /gene_synonym="CTR BETA 2; NR1A2; TR-BETA"
                     /note="coactivator recognition site [polypeptide binding];
                     other site"
                     /db_xref="CDD:132733"
     misc_feature    order(824..826,959..961,1049..1051,1058..1063,1070..1072,
                     1079..1084,1088..1093)
                     /gene="THRB"
                     /gene_synonym="CTR BETA 2; NR1A2; TR-BETA"
                     /note="dimer interface [polypeptide binding]; other site"
                     /db_xref="CDD:132733"
     exon            66..166
                     /gene="THRB"
                     /gene_synonym="CTR BETA 2; NR1A2; TR-BETA"
                     /inference="alignment:Splign:2.1.0"
     exon            167..314
                     /gene="THRB"
                     /gene_synonym="CTR BETA 2; NR1A2; TR-BETA"
                     /inference="alignment:Splign:2.1.0"
     exon            315..520
                     /gene="THRB"
                     /gene_synonym="CTR BETA 2; NR1A2; TR-BETA"
                     /inference="alignment:Splign:2.1.0"
     exon            521..667
                     /gene="THRB"
                     /gene_synonym="CTR BETA 2; NR1A2; TR-BETA"
                     /inference="alignment:Splign:2.1.0"
     exon            668..926
                     /gene="THRB"
                     /gene_synonym="CTR BETA 2; NR1A2; TR-BETA"
                     /inference="alignment:Splign:2.1.0"
     exon            927..1412
                     /gene="THRB"
                     /gene_synonym="CTR BETA 2; NR1A2; TR-BETA"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
gtggcagtggtgacagaagaagaacaagaatgattacgtatctgtaactctcagcagtatgtcagggtatatacccagttacttagacaaggatgagctatgtgtagtatgtggggacaaagccaccggatatcattatcgctgcatcacttgtgaaggttgcaagggatttttcagaagaaccattcagaaaaacctccatccaacctattcctgtaaatatgaaggaaaatgtgtgatagacaaagtaacaagaaatcagtgccaggaatgtcgcttcaaaaaatgtatctttgttggcatggcaacagatttggtgttggatgacagcaagaggctggcaaagaggaagctgatagaagaaaatcgagagaagaggcgtcgggaagagctgcagaaaacgattggtcacaaaccagaaccaacagatgaggaatgggagctgatcaaaattgtcactgaagcacatgtggccaccaatgcacaaggaagccactggaagcagaaaaggaaatttctgccagaagacattgggcaagcaccaatagttaatgccccagaaggggggaaagtggatttagaagccttcagccagtttacaaaaattatcacaccagcgattacaagagtggtggattttgccaaaaagttgcctatgttttgtgagctgccatgtgaagaccagatcatccttctgaaaggctgctgtatggagataatgtccctccgagcagcagttcgctatgaccccgagagtgagactttaacgctaaatggggagatggcggtgacaaggggccagctgaaaaatgggggtcttggcgtagtttctgatgccatttttgacctgggcatgtctctttcttcatttaacctggatgacaccgaggttgcccttctccaggctgtcctgctcatgtcatcagatcgcccaggccttgtttgcgtcgagagaatagaaaagtgtcaagagggtttcctcctggcatttgaacactacattaattacagaaaacaccatgttgcacatttttggccaaaactgctgatgaaagtgacagatctgcgaatgattggagcctgccatgccagccgcttcctgcacatgaaggtggagtgccccacagaactcttccctccattgttcctggaggtgtttgaggattagagagactggagcggtcctctgcacccctgtcgcactactggctgtcattccattccattgcccagctcttctcacacctgtttgttcttcttttgttatcttctgattcttgaggtggggttgggcttttgtttgagtttttctctggggttgctgggggcagttgtatacacatggatgaaaacatccctttctgctggtacttgtgactattgcaatttgttcttcagtcctttgatgtgaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]