2024-07-01 22:01:04, GGRNA.v2 : RefSeq release 224 (May, 2024)
LOCUS NM_205447 1412 bp mRNA linear VRT 01-FEB-2024 DEFINITION Gallus gallus thyroid hormone receptor beta (THRB), transcript variant 1, mRNA. ACCESSION NM_205447 VERSION NM_205447.2 KEYWORDS RefSeq. SOURCE Gallus gallus (chicken) ORGANISM Gallus gallus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes; Phasianidae; Phasianinae; Gallus. REFERENCE 1 (bases 1 to 1412) AUTHORS Tang,H., Finn,R.D. and Thomas,P.D. TITLE TreeGrafter: phylogenetic tree-based annotation of proteins with Gene Ontology terms and other annotations JOURNAL Bioinformatics 35 (3), 518-520 (2019) PUBMED 30032202 REFERENCE 2 (bases 1 to 1412) AUTHORS Burge,S., Kelly,E., Lonsdale,D., Mutowo-Muellenet,P., McAnulla,C., Mitchell,A., Sangrador-Vegas,A., Yong,S.Y., Mulder,N. and Hunter,S. TITLE Manual GO annotation of predictive protein signatures: the InterPro approach to GO curation JOURNAL Database (Oxford) 2012, bar068 (2012) PUBMED 22301074 REMARK Publication Status: Online-Only REFERENCE 3 (bases 1 to 1412) AUTHORS Lassova,L., Niu,Z., Golden,E.B., Cohen,A.J. and Adams,S.L. TITLE Thyroid hormone treatment of cultured chondrocytes mimics in vivo stimulation of collagen X mRNA by increasing BMP 4 expression JOURNAL J Cell Physiol 219 (3), 595-605 (2009) PUBMED 19170125 REFERENCE 4 (bases 1 to 1412) AUTHORS Grommen,S.V., Arckens,L., Theuwissen,T., Darras,V.M. and De Groef,B. TITLE Thyroid hormone receptor beta2 is strongly up-regulated at all levels of the hypothalamo-pituitary-thyroidal axis during late embryogenesis in chicken JOURNAL J Endocrinol 196 (3), 519-528 (2008) PUBMED 18310447 REMARK GeneRIF: changes occur in thyroid hormone (TH) receptor beta2 (TRbeta2) expression at the different levels of the hypothalamo-pituitary-thyroidal (HPT) axis during the last week of chicken embryonic development and hatching REFERENCE 5 (bases 1 to 1412) AUTHORS Cho,Y.S., Kim,E.J., Park,U.H., Sin,H.S. and Um,S.J. TITLE Additional sex comb-like 1 (ASXL1), in cooperation with SRC-1, acts as a ligand-dependent coactivator for retinoic acid receptor JOURNAL J Biol Chem 281 (26), 17588-17598 (2006) PUBMED 16606617 REFERENCE 6 (bases 1 to 1412) AUTHORS Boardman,P.E., Sanz-Ezquerro,J., Overton,I.M., Burt,D.W., Bosch,E., Fong,W.T., Tickle,C., Brown,W.R., Wilson,S.A. and Hubbard,S.J. TITLE A comprehensive collection of chicken cDNAs JOURNAL Curr Biol 12 (22), 1965-1969 (2002) PUBMED 12445392 REFERENCE 7 (bases 1 to 1412) AUTHORS Lachuer,J., Legras,C., Ronfort,C., Barges,S., Cohen-Adad,F., Quivet,L., Duchamp,C., Verdier,G. and Barre,H. TITLE Molecular cloning and sequencing of a cDNA encoding a beta-thyroid hormone receptor in muscovy duckling JOURNAL Biochim Biophys Acta 1310 (1), 127-130 (1996) PUBMED 9244185 REFERENCE 8 (bases 1 to 1412) AUTHORS Sjoberg,M., Vennstrom,B. and Forrest,D. TITLE Thyroid hormone receptors in chick retinal development: differential expression of mRNAs for alpha and N-terminal variant beta receptors JOURNAL Development 114 (1), 39-47 (1992) PUBMED 1576965 REFERENCE 9 (bases 1 to 1412) AUTHORS Showers,M.O., Darling,D.S., Kieffer,G.D. and Chin,W.W. TITLE Isolation and characterization of a cDNA encoding a chicken beta thyroid hormone receptor JOURNAL DNA Cell Biol 10 (3), 211-221 (1991) PUBMED 1707280 REFERENCE 10 (bases 1 to 1412) AUTHORS Forrest,D., Sjoberg,M. and Vennstrom,B. TITLE Contrasting developmental and tissue-specific expression of alpha and beta thyroid hormone receptor genes JOURNAL EMBO J 9 (5), 1519-1528 (1990) PUBMED 1970296 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from X17504.1 and Z50188.1. On Oct 25, 2013 this sequence version replaced NM_205447.1. Transcript Variant: This variant (1) represents the shorter transcript and encodes the shorter protein (isoform 1). Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: X17504.1, Z50188.1 [ECO:0000332] RNAseq introns :: mixed sample support SAMEA103992290, SAMEA103992323 [ECO:0006172] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-22 X17504.1 24-45 23-1193 Z50188.1 1-1171 1194-1412 X17504.1 1217-1435 FEATURES Location/Qualifiers source 1..1412 /organism="Gallus gallus" /mol_type="mRNA" /db_xref="taxon:9031" /chromosome="2" /map="2" /breed="SPAFAS" gene 1..1412 /gene="THRB" /gene_synonym="CTR BETA 2; NR1A2; TR-BETA" /note="thyroid hormone receptor beta" /db_xref="CGNC:49800" /db_xref="GeneID:396431" exon 1..65 /gene="THRB" /gene_synonym="CTR BETA 2; NR1A2; TR-BETA" /inference="alignment:Splign:2.1.0" misc_feature 11..13 /gene="THRB" /gene_synonym="CTR BETA 2; NR1A2; TR-BETA" /note="upstream in-frame stop codon" CDS 59..1168 /gene="THRB" /gene_synonym="CTR BETA 2; NR1A2; TR-BETA" /note="isoform 1 is encoded by transcript variant 1; beta-thyroid hormone receptor; nuclear receptor subfamily 1 group A member 2; thyroid hormone receptor beta 2; thyroid hormone receptor, beta (erythroblastic leukemia viral (v-erb-a) oncogene homolog 2, avian); C-ERBA-BETA" /codon_start=1 /product="thyroid hormone receptor beta isoform 1" /protein_id="NP_990778.2" /db_xref="CGNC:49800" /db_xref="GeneID:396431" /translation="
MSGYIPSYLDKDELCVVCGDKATGYHYRCITCEGCKGFFRRTIQKNLHPTYSCKYEGKCVIDKVTRNQCQECRFKKCIFVGMATDLVLDDSKRLAKRKLIEENREKRRREELQKTIGHKPEPTDEEWELIKIVTEAHVATNAQGSHWKQKRKFLPEDIGQAPIVNAPEGGKVDLEAFSQFTKIITPAITRVVDFAKKLPMFCELPCEDQIILLKGCCMEIMSLRAAVRYDPESETLTLNGEMAVTRGQLKNGGLGVVSDAIFDLGMSLSSFNLDDTEVALLQAVLLMSSDRPGLVCVERIEKCQEGFLLAFEHYINYRKHHVAHFWPKLLMKVTDLRMIGACHASRFLHMKVECPTELFPPLFLEVFED"
misc_feature 59..100 /gene="THRB" /gene_synonym="CTR BETA 2; NR1A2; TR-BETA" /note="propagated from UniProtKB/Swiss-Prot (P68306.1); Region: Modulating. /evidence=ECO:0000255" misc_feature 98..358 /gene="THRB" /gene_synonym="CTR BETA 2; NR1A2; TR-BETA" /note="DNA-binding domain of thyroid hormone receptors (TRs) is composed of two C4-type zinc fingers; Region: NR_DBD_TR; cd06961" /db_xref="CDD:143519" misc_feature order(101..103,110..112,152..154,161..163,215..217, 233..235,263..265,272..274) /gene="THRB" /gene_synonym="CTR BETA 2; NR1A2; TR-BETA" /note="zinc binding site [ion binding]; other site" /db_xref="CDD:143519" misc_feature order(131..139,155..160,164..166,170..172,176..181, 188..190,254..259,266..268,275..277,314..322,335..337, 344..349,353..358) /gene="THRB" /gene_synonym="CTR BETA 2; NR1A2; TR-BETA" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:143519" misc_feature order(131..133,140..142,305..307,311..316) /gene="THRB" /gene_synonym="CTR BETA 2; NR1A2; TR-BETA" /note="heterodimer interface [polypeptide binding]; other site" /db_xref="CDD:143519" misc_feature 428..1156 /gene="THRB" /gene_synonym="CTR BETA 2; NR1A2; TR-BETA" /note="The ligand binding domain of thyroid hormone receptor, a members of a superfamily of nuclear receptors; Region: NR_LBD_TR; cd06935" /db_xref="CDD:132733" misc_feature order(587..589,596..601,605..610,617..619,626..628, 710..712,719..721,731..733,767..775,803..805,812..814, 818..820,839..841,1085..1087,1106..1108,1145..1147) /gene="THRB" /gene_synonym="CTR BETA 2; NR1A2; TR-BETA" /note="ligand binding site [chemical binding]; other site" /db_xref="CDD:132733" misc_feature order(623..625,632..634,644..646,674..676,686..688, 695..697,1139..1144,1151..1153) /gene="THRB" /gene_synonym="CTR BETA 2; NR1A2; TR-BETA" /note="coactivator recognition site [polypeptide binding]; other site" /db_xref="CDD:132733" misc_feature order(824..826,959..961,1049..1051,1058..1063,1070..1072, 1079..1084,1088..1093) /gene="THRB" /gene_synonym="CTR BETA 2; NR1A2; TR-BETA" /note="dimer interface [polypeptide binding]; other site" /db_xref="CDD:132733" exon 66..166 /gene="THRB" /gene_synonym="CTR BETA 2; NR1A2; TR-BETA" /inference="alignment:Splign:2.1.0" exon 167..314 /gene="THRB" /gene_synonym="CTR BETA 2; NR1A2; TR-BETA" /inference="alignment:Splign:2.1.0" exon 315..520 /gene="THRB" /gene_synonym="CTR BETA 2; NR1A2; TR-BETA" /inference="alignment:Splign:2.1.0" exon 521..667 /gene="THRB" /gene_synonym="CTR BETA 2; NR1A2; TR-BETA" /inference="alignment:Splign:2.1.0" exon 668..926 /gene="THRB" /gene_synonym="CTR BETA 2; NR1A2; TR-BETA" /inference="alignment:Splign:2.1.0" exon 927..1412 /gene="THRB" /gene_synonym="CTR BETA 2; NR1A2; TR-BETA" /inference="alignment:Splign:2.1.0" ORIGIN
gtggcagtggtgacagaagaagaacaagaatgattacgtatctgtaactctcagcagtatgtcagggtatatacccagttacttagacaaggatgagctatgtgtagtatgtggggacaaagccaccggatatcattatcgctgcatcacttgtgaaggttgcaagggatttttcagaagaaccattcagaaaaacctccatccaacctattcctgtaaatatgaaggaaaatgtgtgatagacaaagtaacaagaaatcagtgccaggaatgtcgcttcaaaaaatgtatctttgttggcatggcaacagatttggtgttggatgacagcaagaggctggcaaagaggaagctgatagaagaaaatcgagagaagaggcgtcgggaagagctgcagaaaacgattggtcacaaaccagaaccaacagatgaggaatgggagctgatcaaaattgtcactgaagcacatgtggccaccaatgcacaaggaagccactggaagcagaaaaggaaatttctgccagaagacattgggcaagcaccaatagttaatgccccagaaggggggaaagtggatttagaagccttcagccagtttacaaaaattatcacaccagcgattacaagagtggtggattttgccaaaaagttgcctatgttttgtgagctgccatgtgaagaccagatcatccttctgaaaggctgctgtatggagataatgtccctccgagcagcagttcgctatgaccccgagagtgagactttaacgctaaatggggagatggcggtgacaaggggccagctgaaaaatgggggtcttggcgtagtttctgatgccatttttgacctgggcatgtctctttcttcatttaacctggatgacaccgaggttgcccttctccaggctgtcctgctcatgtcatcagatcgcccaggccttgtttgcgtcgagagaatagaaaagtgtcaagagggtttcctcctggcatttgaacactacattaattacagaaaacaccatgttgcacatttttggccaaaactgctgatgaaagtgacagatctgcgaatgattggagcctgccatgccagccgcttcctgcacatgaaggtggagtgccccacagaactcttccctccattgttcctggaggtgtttgaggattagagagactggagcggtcctctgcacccctgtcgcactactggctgtcattccattccattgcccagctcttctcacacctgtttgttcttcttttgttatcttctgattcttgaggtggggttgggcttttgtttgagtttttctctggggttgctgggggcagttgtatacacatggatgaaaacatccctttctgctggtacttgtgactattgcaatttgttcttcagtcctttgatgtgaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]