GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-10-15 15:34:50, GGRNA.v2 : RefSeq release 232 (Sep, 2025)

LOCUS       NM_205434               1964 bp    mRNA    linear   VRT 28-APR-2025
DEFINITION  Gallus gallus homeobox D13 (HOXD13), mRNA.
ACCESSION   NM_205434 XM_429309
VERSION     NM_205434.1
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
REFERENCE   1  (bases 1 to 1964)
  AUTHORS   Tang,H., Finn,R.D. and Thomas,P.D.
  TITLE     TreeGrafter: phylogenetic tree-based annotation of proteins with
            Gene Ontology terms and other annotations
  JOURNAL   Bioinformatics 35 (3), 518-520 (2019)
   PUBMED   30032202
REFERENCE   2  (bases 1 to 1964)
  AUTHORS   Burge,S., Kelly,E., Lonsdale,D., Mutowo-Muellenet,P., McAnulla,C.,
            Mitchell,A., Sangrador-Vegas,A., Yong,S.Y., Mulder,N. and Hunter,S.
  TITLE     Manual GO annotation of predictive protein signatures: the InterPro
            approach to GO curation
  JOURNAL   Database (Oxford) 2012, bar068 (2012)
   PUBMED   22301074
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1964)
  AUTHORS   Bangs,F., Welten,M., Davey,M.G., Fisher,M., Yin,Y., Downie,H.,
            Paton,B., Baldock,R., Burt,D.W. and Tickle,C.
  TITLE     Identification of genes downstream of the Shh signalling in the
            developing chick wing and syn-expressed with Hoxd13 using
            microarray and 3D computational analysis
  JOURNAL   Mech Dev 127 (9-12), 428-441 (2010)
   PUBMED   20708683
  REMARK    GeneRIF: Hoxd13 and Sall1 are syn-expressed in the posterior region
            of early chick wing buds together with 6 novel genes which are
            likely to be functionally related and represent secondary targets
            of Shh signalling.
REFERENCE   4  (bases 1 to 1964)
  AUTHORS   Rogina,B. and Upholt,W.B.
  TITLE     Cloning of full coding chicken cDNAs for the homeobox-containing
            gene Hoxd-13
  JOURNAL   Nucleic Acids Res 21 (5), 1316 (1993)
   PUBMED   8096637
REFERENCE   5  (bases 1 to 1964)
  AUTHORS   Izpisua-Belmonte,J.C., Tickle,C., Dolle,P., Wolpert,L. and
            Duboule,D.
  TITLE     Expression of the homeobox Hox-4 genes and the specification of
            position in chick wing development
  JOURNAL   Nature 350 (6319), 585-589 (1991)
   PUBMED   1673231
REFERENCE   6  (bases 1 to 1964)
  AUTHORS   Nohno,T., Noji,S., Koyama,E., Ohyama,K., Myokai,F., Kuroiwa,A.,
            Saito,T. and Taniguchi,S.
  TITLE     Involvement of the Chox-4 chicken homeobox genes in determination
            of anteroposterior axial polarity during limb development
  JOURNAL   Cell 64 (6), 1197-1205 (1991)
   PUBMED   1672266
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from L09550.1.
            
            On Aug 30, 2004 this sequence version replaced XM_429309.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: L09550.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA3109051, SAMN08016554
                                           [ECO:0000348]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..1964
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /db_xref="taxon:9031"
                     /chromosome="7"
                     /map="7"
                     /breed="Leghorn"
     gene            1..1964
                     /gene="HOXD13"
                     /gene_synonym="chox-4.8; chox-4G"
                     /note="homeobox D13"
                     /db_xref="CGNC:7049"
                     /db_xref="GeneID:396415"
     CDS             11..916
                     /gene="HOXD13"
                     /gene_synonym="chox-4.8; chox-4G"
                     /note="homeobox protein hoxd13; homeobox protein Hox-4G;
                     homeobox protein Hox-4.8; Hox D13"
                     /codon_start=1
                     /product="homeobox protein Hox-D13"
                     /protein_id="NP_990765.1"
                     /db_xref="CGNC:7049"
                     /db_xref="GeneID:396415"
                     /translation="
MDGLRGDSSGGGGGGGTPGQCRNFLSSPVFGAAHTGRAAAAAAAAASGFAYAGGGERSGAAARPDPPAKDCPGSGAPPAAPALGYGYHFGNGYYSCRMSNGVGIQQNALKSPPHASIGGFPVEKYMDVSSLTSTSVPANEVSTRAKEVSSYQGYTNPYQHVPGYIDMVSTFGSGEPRHETYISMEGYQSWTLANGWNGQVYCAKDQTQSSHFWKSSFPGDVALNQPEMCVYRRGRKKRVPYTKLQLKELENEYAINKFINKDKRRRISAATNLSERQVTIWFQNRRVKDKKIVSKLKDNVS"
     misc_feature    11..70
                     /gene="HOXD13"
                     /gene_synonym="chox-4.8; chox-4G"
                     /note="propagated from UniProtKB/Swiss-Prot (P24344.3);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    68..442
                     /gene="HOXD13"
                     /gene_synonym="chox-4.8; chox-4G"
                     /note="Hox protein A13 N terminal; Region: HoxA13_N;
                     pfam12284"
                     /db_xref="CDD:463521"
     misc_feature    173..235
                     /gene="HOXD13"
                     /gene_synonym="chox-4.8; chox-4G"
                     /note="propagated from UniProtKB/Swiss-Prot (P24344.3);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    713..883
                     /gene="HOXD13"
                     /gene_synonym="chox-4.8; chox-4G"
                     /note="Region: Homeodomain; pfam00046"
                     /db_xref="CDD:459649"
     polyA_site      1218
                     /gene="HOXD13"
                     /gene_synonym="chox-4.8; chox-4G"
                     /note="alternate"
ORIGIN      
gggctgggagatggacggactgcgcggcgacagcagcggcggcggcggcggcggcggcacccccgggcagtgccgtaactttctctcctcgcccgttttcggcgcggcgcacacgggccgcgcggccgccgccgccgccgccgccgcctcggggttcgcctacgccggcggaggggagcgctcgggggcggcggcgcggcccgaccccccggccaaggactgcccgggctccggcgcgccgcccgccgcccccgcgctcggctacgggtatcactttggcaacggatactatagctgcaggatgtccaacggggttgggatccagcagaacgccctgaagtctcccccccatgcctccattggcggctttcccgtggaaaagtacatggacgtctccagtctgaccagcacgagtgtccccgccaatgaagtctccaccagggctaaagaagtgtcctcctaccagggctatacaaacccctaccagcacgttcctgggtacatagacatggtctcaacgtttggctctggggaaccgagacacgaaacgtacatatccatggagggctatcagtcctggactctggctaatggctggaacggccaggtgtactgtgccaaagatcagacacagagctcgcacttctggaaatcgtcctttccaggggacgttgcactaaaccagcccgagatgtgcgtctaccggcgcgggaggaagaagagagtgccctacaccaagctccagcttaaggaactcgagaacgaatacgccattaacaagttcattaacaaggacaagaggcgaaggatatccgcggccacgaacctgtccgaacgccaggtcaccatttggtttcagaacaggagggtgaaggataagaaaatagtctccaaactgaaagacaacgtttcttgatcgattccttgcggacagtggcggatatacaacctccgtttacgaccagctgcggacttttggaaagacttgaaaatatatttaatattttttttctcttctccttccagcggtggcgaagtttcgtgaattgttttctattcccgtgaaagccggcgttgttctctcggtggaagggagcgccgacaagccgtgactttagcgttgtttcttccttcctttttttaaaaaaaaataatattaatattaattatattttctatccttccctctaggccagtataaacgaatttaaacgtgtcgaacggttccatttataactttcttaaatgcttatctctttggggaggggacccggggtttttatctccgaacgtcggccggtgcccgaaagtgtcggactcgatttggtgtattggtcggaaaacgcgagtgagcgcgttcccgcagtcactgccggcaaaagccgcattgccggagtccgcacggggctccgcggatgtcggaagcagcggctccggaagggaattgtttgcactgcagtgggatcgctctttttattctttatgatttgattttgctggcgggcaatctgctaccggcttttcctggggtacggagcgcggcctcggctcctctcgttggatccgaaggggcagcgatgctccccgcagcagcgcccgggggtccctccggccgccccgtcccatcccgtcccgtcccgtcccgtcccgtcccgaggtgcgcacgtacctccgtgcggaccccgcgtgcgcataacgcacttcccggtcggagaagtgaagttcaccgctaactttcagtttgcaaaactaaacgggtgttaatgacagaagcaataaatgattcgtttcaaaagatgccataatttatgtaggccgaaaggctgggactcggttgggtttttgtaattttaaacctagcgtgcatgttatgctatacgcagggaggtcagctcctgggaaagagaagcgatgtcctccctgttcatgtgcctcgtgtaattattaaatggtgtgtgtttcga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]