ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2025-12-24 01:29:20, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS NM_205386 1830 bp mRNA linear VRT 24-SEP-2023 DEFINITION Gallus gallus sensory organ homeobox (SOHO1), mRNA. ACCESSION NM_205386 VERSION NM_205386.2 KEYWORDS RefSeq. SOURCE Gallus gallus (chicken) ORGANISM Gallus gallus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes; Phasianidae; Phasianinae; Gallus. REFERENCE 1 (bases 1 to 1830) AUTHORS Tang H, Finn RD and Thomas PD. TITLE TreeGrafter: phylogenetic tree-based annotation of proteins with Gene Ontology terms and other annotations JOURNAL Bioinformatics 35 (3), 518-520 (2019) PUBMED 30032202 REFERENCE 2 (bases 1 to 1830) AUTHORS Burge S, Kelly E, Lonsdale D, Mutowo-Muellenet P, McAnulla C, Mitchell A, Sangrador-Vegas A, Yong SY, Mulder N and Hunter S. TITLE Manual GO annotation of predictive protein signatures: the InterPro approach to GO curation JOURNAL Database (Oxford) 2012, bar068 (2012) PUBMED 22301074 REMARK Publication Status: Online-Only REFERENCE 3 (bases 1 to 1830) AUTHORS Deitcher DL, Fekete DM and Cepko CL. TITLE Asymmetric expression of a novel homeobox gene in vertebrate sensory organs JOURNAL J Neurosci 14 (2), 486-498 (1994) PUBMED 7905512 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from JAENSK010000074.1. On Oct 18, 2021 this sequence version replaced NM_205386.1. ##Evidence-Data-START## Transcript exon combination :: U35815.1, S69380.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA103992440, SAMEA103992453 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: full length. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-273 JAENSK010000074.1 33945044-33945316 c 274-1830 JAENSK010000074.1 33943030-33944586 c FEATURES Location/Qualifiers source 1..1830 /organism="Gallus gallus" /mol_type="mRNA" /db_xref="taxon:9031" /chromosome="4" /map="4" gene 1..1830 /gene="SOHO1" /gene_synonym="SOHO-1" /note="sensory organ homeobox" /db_xref="CGNC:49762" /db_xref="GeneID:396346" exon 1..273 /gene="SOHO1" /gene_synonym="SOHO-1" /inference="alignment:Splign:2.1.0" misc_feature 45..47 /gene="SOHO1" /gene_synonym="SOHO-1" /note="upstream in-frame stop codon" CDS 60..839 /gene="SOHO1" /gene_synonym="SOHO-1" /note="sensory organ homeobox protein SOHo" /codon_start=1 /product="sensory organ homeobox" /protein_id="NP_990717.2" /db_xref="CGNC:49762" /db_xref="GeneID:396346" /translation="
MVQLGGGRGAPPPLLAPPSAFSIDSILQPGPRCQAREQGRARCALPEDEEEEEEEEEGPAEEHPTKGSTDSGSERLLAEGPRRADAEAEGAVSPLSTERFRGCRQPSLRDTGGCGRESGRCSAAGGKKKTRTIFSKSQVFQLESTFDVKRYLSSAERAGLAAALHLTETQVKIWFQNRRNKLKRQLSAEPEGPGQAETPGEPPPPPAASFSFPALYKDSALLSRCLLPLPFPLFYPGSAIPYLCLPGPVKHFSLLDGDV"
misc_feature 441..611
/gene="SOHO1"
/gene_synonym="SOHO-1"
/note="Region: Homeodomain; pfam00046"
/db_xref="CDD:459649"
exon 274..1830
/gene="SOHO1"
/gene_synonym="SOHO-1"
/inference="alignment:Splign:2.1.0"
ORIGIN
ctccgccccggctgccgccttccctccgccgccactcctgcggttaggctcagcgcgccatggtgcagctcgggggaggccgcggagccccaccgcctctcctggccccaccgtcggccttcagcatcgacagcatcctgcagcccggtccccgctgccaggcccgggagcaggggagggcccgctgcgcgctgccggaggacgaggaggaggaggaggaggaagaagaggggcctgcggaggaacaccccactaaaggctccaccgactcgggcagcgagaggctgctggcggaagggccgcgccgcgcggatgccgaggccgaaggcgcggtttcaccgctctccacggagaggttccgcggatgccgacagccgtcgctgcgggataccgggggctgcggtagagagagcggcaggtgttcagcggcgggaggcaagaagaagacgcggaccatcttctccaagagccaggtcttccagctggagtccaccttcgacgtgaagcgctacctgagcagcgccgagcgggccggtctggccgccgcgttgcacctcaccgagacgcaggtgaagatctggttccagaaccgccgcaacaagctcaagagacagctgtcggctgaacccgagggtccgggccaagcggaaaccccaggggagccccctccgcctcccgccgcctctttctccttcccggccctatacaaggacagcgccctgctcagccgctgcctgctgccactccccttccctctattctacccgggcagcgccatcccctacctctgccttcccggtccggtcaagcacttcagcctgctggacggggacgtatagcctctcccctcggcccccgccctgtctcttgcagggggccgatggtccctgtggcacagccgtaccaccatcagctttcgccccgacacgcggcagccgctcccaggcccggggtcccccacacgctgccgtgtgccgccgtgtcagaggagcatcaacgagcgctgcactctgctcgagacggagaagaacggagctgccaaagaaaccgggatgcgctgtgtctcctttccctccacagcctttccgtggccgcagtttaggaaagatgatattctgcctcagtccacgggaatggtgccatcgcggctgcccccgcaccgtaccgccacccgagagcgttgggtacagccccatccactccgtacgctcctctatctcacattctccgcctttagtacaccttcaattaacgcttccccatctctgacactatcaaaatgcagacacctctctaaatctctgtagcttctctgaattttgaattttcgaaccaaacaagtcctctgtcacactttgtgctaaccggttcccaaatcagggcccgtctgatgtttggcgcacaacttactcatgctccttacgctaaccccgcccccggttgctcaggggattattttatctgctgccctactgtaacgaagtgctttcttttgttttttgttttaatcccccttaaatctccaaccacatttgtcttcttttggtttccgagttcacacgctttatattacaaattgggaaataaaacttttctatcagaaacccgagctgcatgcctgttccgtacagccgctccagggcagtgtccaaagaaagacgtttcctagagtgcatcgacgggtgtttgttttaaaaataaaggttgaacgtgcaatcgtggtgtggcgaaattcagaagtgcgtgctaaaatgggagacatgttgaggttttccagagggaaaaaaataataataaaaagaaaaaaaaataaagaaaagaaaaagagaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]