GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-07-13 16:04:56, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       NM_205386               1830 bp    mRNA    linear   VRT 24-SEP-2023
DEFINITION  Gallus gallus sensory organ homeobox (SOHO1), mRNA.
ACCESSION   NM_205386
VERSION     NM_205386.2
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
REFERENCE   1  (bases 1 to 1830)
  AUTHORS   Tang H, Finn RD and Thomas PD.
  TITLE     TreeGrafter: phylogenetic tree-based annotation of proteins with
            Gene Ontology terms and other annotations
  JOURNAL   Bioinformatics 35 (3), 518-520 (2019)
   PUBMED   30032202
REFERENCE   2  (bases 1 to 1830)
  AUTHORS   Burge S, Kelly E, Lonsdale D, Mutowo-Muellenet P, McAnulla C,
            Mitchell A, Sangrador-Vegas A, Yong SY, Mulder N and Hunter S.
  TITLE     Manual GO annotation of predictive protein signatures: the InterPro
            approach to GO curation
  JOURNAL   Database (Oxford) 2012, bar068 (2012)
   PUBMED   22301074
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1830)
  AUTHORS   Deitcher DL, Fekete DM and Cepko CL.
  TITLE     Asymmetric expression of a novel homeobox gene in vertebrate
            sensory organs
  JOURNAL   J Neurosci 14 (2), 486-498 (1994)
   PUBMED   7905512
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JAENSK010000074.1.
            
            On Oct 18, 2021 this sequence version replaced NM_205386.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: U35815.1, S69380.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA103992440, SAMEA103992453
                                           [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-273               JAENSK010000074.1  33945044-33945316   c
            274-1830            JAENSK010000074.1  33943030-33944586   c
FEATURES             Location/Qualifiers
     source          1..1830
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /db_xref="taxon:9031"
                     /chromosome="4"
                     /map="4"
     gene            1..1830
                     /gene="SOHO1"
                     /gene_synonym="SOHO-1"
                     /note="sensory organ homeobox"
                     /db_xref="CGNC:49762"
                     /db_xref="GeneID:396346"
     exon            1..273
                     /gene="SOHO1"
                     /gene_synonym="SOHO-1"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    45..47
                     /gene="SOHO1"
                     /gene_synonym="SOHO-1"
                     /note="upstream in-frame stop codon"
     CDS             60..839
                     /gene="SOHO1"
                     /gene_synonym="SOHO-1"
                     /note="sensory organ homeobox protein SOHo"
                     /codon_start=1
                     /product="sensory organ homeobox"
                     /protein_id="NP_990717.2"
                     /db_xref="CGNC:49762"
                     /db_xref="GeneID:396346"
                     /translation="
MVQLGGGRGAPPPLLAPPSAFSIDSILQPGPRCQAREQGRARCALPEDEEEEEEEEEGPAEEHPTKGSTDSGSERLLAEGPRRADAEAEGAVSPLSTERFRGCRQPSLRDTGGCGRESGRCSAAGGKKKTRTIFSKSQVFQLESTFDVKRYLSSAERAGLAAALHLTETQVKIWFQNRRNKLKRQLSAEPEGPGQAETPGEPPPPPAASFSFPALYKDSALLSRCLLPLPFPLFYPGSAIPYLCLPGPVKHFSLLDGDV"
     misc_feature    441..611
                     /gene="SOHO1"
                     /gene_synonym="SOHO-1"
                     /note="Region: Homeodomain; pfam00046"
                     /db_xref="CDD:459649"
     exon            274..1830
                     /gene="SOHO1"
                     /gene_synonym="SOHO-1"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
ctccgccccggctgccgccttccctccgccgccactcctgcggttaggctcagcgcgccatggtgcagctcgggggaggccgcggagccccaccgcctctcctggccccaccgtcggccttcagcatcgacagcatcctgcagcccggtccccgctgccaggcccgggagcaggggagggcccgctgcgcgctgccggaggacgaggaggaggaggaggaggaagaagaggggcctgcggaggaacaccccactaaaggctccaccgactcgggcagcgagaggctgctggcggaagggccgcgccgcgcggatgccgaggccgaaggcgcggtttcaccgctctccacggagaggttccgcggatgccgacagccgtcgctgcgggataccgggggctgcggtagagagagcggcaggtgttcagcggcgggaggcaagaagaagacgcggaccatcttctccaagagccaggtcttccagctggagtccaccttcgacgtgaagcgctacctgagcagcgccgagcgggccggtctggccgccgcgttgcacctcaccgagacgcaggtgaagatctggttccagaaccgccgcaacaagctcaagagacagctgtcggctgaacccgagggtccgggccaagcggaaaccccaggggagccccctccgcctcccgccgcctctttctccttcccggccctatacaaggacagcgccctgctcagccgctgcctgctgccactccccttccctctattctacccgggcagcgccatcccctacctctgccttcccggtccggtcaagcacttcagcctgctggacggggacgtatagcctctcccctcggcccccgccctgtctcttgcagggggccgatggtccctgtggcacagccgtaccaccatcagctttcgccccgacacgcggcagccgctcccaggcccggggtcccccacacgctgccgtgtgccgccgtgtcagaggagcatcaacgagcgctgcactctgctcgagacggagaagaacggagctgccaaagaaaccgggatgcgctgtgtctcctttccctccacagcctttccgtggccgcagtttaggaaagatgatattctgcctcagtccacgggaatggtgccatcgcggctgcccccgcaccgtaccgccacccgagagcgttgggtacagccccatccactccgtacgctcctctatctcacattctccgcctttagtacaccttcaattaacgcttccccatctctgacactatcaaaatgcagacacctctctaaatctctgtagcttctctgaattttgaattttcgaaccaaacaagtcctctgtcacactttgtgctaaccggttcccaaatcagggcccgtctgatgtttggcgcacaacttactcatgctccttacgctaaccccgcccccggttgctcaggggattattttatctgctgccctactgtaacgaagtgctttcttttgttttttgttttaatcccccttaaatctccaaccacatttgtcttcttttggtttccgagttcacacgctttatattacaaattgggaaataaaacttttctatcagaaacccgagctgcatgcctgttccgtacagccgctccagggcagtgtccaaagaaagacgtttcctagagtgcatcgacgggtgtttgttttaaaaataaaggttgaacgtgcaatcgtggtgtggcgaaattcagaagtgcgtgctaaaatgggagacatgttgaggttttccagagggaaaaaaataataataaaaagaaaaaaaaataaagaaaagaaaaagagaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]