2024-07-01 22:52:08, GGRNA.v2 : RefSeq release 224 (May, 2024)
LOCUS NM_205267 1268 bp mRNA linear VRT 17-FEB-2024 DEFINITION Gallus gallus nucleophosmin (NPM1), mRNA. ACCESSION NM_205267 VERSION NM_205267.2 KEYWORDS RefSeq. SOURCE Gallus gallus (chicken) ORGANISM Gallus gallus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes; Phasianidae; Phasianinae; Gallus. REFERENCE 1 (bases 1 to 1268) AUTHORS Tang,H., Finn,R.D. and Thomas,P.D. TITLE TreeGrafter: phylogenetic tree-based annotation of proteins with Gene Ontology terms and other annotations JOURNAL Bioinformatics 35 (3), 518-520 (2019) PUBMED 30032202 REFERENCE 2 (bases 1 to 1268) AUTHORS Duan,Z., Chen,J., Xu,H., Zhu,J., Li,Q., He,L., Liu,H., Hu,S. and Liu,X. TITLE The nucleolar phosphoprotein B23 targets Newcastle disease virus matrix protein to the nucleoli and facilitates viral replication JOURNAL Virology 452-453, 212-222 (2014) PUBMED 24606698 REMARK GeneRIF: Phosphoprotein B23 targets Newcastle disease virus matrix protein to the nucleoli and facilitates viral replication. REFERENCE 3 (bases 1 to 1268) AUTHORS Duan,Z., Chen,J., He,L., Xu,H., Li,Q., Hu,S. and Liu,X. TITLE [Matrix protein of Newcastle disease virus interacts with avian nucleophosmin B23. 1 in HEK-293T cells] JOURNAL Wei Sheng Wu Xue Bao 53 (7), 730-736 (2013) PUBMED 24195380 REMARK GeneRIF: Matrix protein of Newcastle disease virus interacts with chicken nucleophosmin B23.1. REFERENCE 4 (bases 1 to 1268) AUTHORS Mukudai,Y., Kubota,S., Kawaki,H., Kondo,S., Eguchi,T., Sumiyoshi,K., Ohgawara,T., Shimo,T. and Takigawa,M. TITLE Posttranscriptional regulation of chicken ccn2 gene expression by nucleophosmin/B23 during chondrocyte differentiation JOURNAL Mol Cell Biol 28 (19), 6134-6147 (2008) PUBMED 18678650 REMARK GeneRIF: The present study reveals a novel aspect of NPM/B23 as a key player in the posttranscriptional regulation of ccn2 mRNA during the differentiation of chondrocytes. REFERENCE 5 (bases 1 to 1268) AUTHORS Hubbard,S.J., Grafham,D.V., Beattie,K.J., Overton,I.M., McLaren,S.R., Croning,M.D., Boardman,P.E., Bonfield,J.K., Burnside,J., Davies,R.M., Farrell,E.R., Francis,M.D., Griffiths-Jones,S., Humphray,S.J., Hyland,C., Scott,C.E., Tang,H., Taylor,R.G., Tickle,C., Brown,W.R., Birney,E., Rogers,J. and Wilson,S.A. TITLE Transcriptome analysis for the chicken based on 19,626 finished cDNA sequences and 485,337 expressed sequence tags JOURNAL Genome Res 15 (1), 174-183 (2005) PUBMED 15590942 REFERENCE 6 (bases 1 to 1268) AUTHORS Maridor,G., Krek,W. and Nigg,E.A. TITLE Structure and developmental expression of chicken nucleolin and NO38: coordinate expression of two abundant non-ribosomal nucleolar proteins JOURNAL Biochim Biophys Acta 1049 (2), 126-133 (1990) PUBMED 2114180 REFERENCE 7 (bases 1 to 1268) AUTHORS Maridor,G. and Nigg,E.A. TITLE cDNA sequences of chicken nucleolin/C23 and NO38/B23, two major nucleolar proteins JOURNAL Nucleic Acids Res 18 (5), 1286 (1990) PUBMED 2320420 REFERENCE 8 (bases 1 to 1268) AUTHORS Borer,R.A., Lehner,C.F., Eppenberger,H.M. and Nigg,E.A. TITLE Major nucleolar proteins shuttle between nucleus and cytoplasm JOURNAL Cell 56 (3), 379-390 (1989) PUBMED 2914325 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from JAENSK010000256.1. On Sep 23, 2021 this sequence version replaced NM_205267.1. ##Evidence-Data-START## Transcript exon combination :: HAEK01012407.1, HAEK01009853.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA103992290, SAMEA103992323 [ECO:0000348] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-127 JAENSK010000256.1 1518579-1518705 c 128-207 JAENSK010000256.1 1517973-1518052 c 208-327 JAENSK010000256.1 1515094-1515213 c 328-421 JAENSK010000256.1 1514373-1514466 c 422-525 JAENSK010000256.1 1513755-1513858 c 526-587 JAENSK010000256.1 1513215-1513276 c 588-642 JAENSK010000256.1 1512778-1512832 c 643-732 JAENSK010000256.1 1511598-1511687 c 733-834 JAENSK010000256.1 1510689-1510790 c 835-909 JAENSK010000256.1 1508837-1508911 c 910-1268 JAENSK010000256.1 1507498-1507856 c FEATURES Location/Qualifiers source 1..1268 /organism="Gallus gallus" /mol_type="mRNA" /db_xref="taxon:9031" /chromosome="13" /map="13" gene 1..1268 /gene="NPM1" /gene_synonym="NO38" /note="nucleophosmin" /db_xref="CGNC:49698" /db_xref="GeneID:396203" exon 1..127 /gene="NPM1" /gene_synonym="NO38" /inference="alignment:Splign:2.1.0" CDS 64..948 /gene="NPM1" /gene_synonym="NO38" /note="nucleolar phosphoprotein B23; NPM; numatrin; nucleolar protein NO38; nucleophosmin (nucleolar phosphoprotein B23, numatrin)" /codon_start=1 /product="nucleophosmin" /protein_id="NP_990598.2" /db_xref="CGNC:49698" /db_xref="GeneID:396203" /translation="
MEDSAMDMESMGPLRPQTFLFGCELKAEKEYQFKVDDEENEHQLSLRTVTLGAGAKDELHVVEAEALDYEGNPTKVVLASLKMSVQPTVSLGGFEITPPVVLRLKCGSGPVYVSGQHLVALEEEPESEDEEEDTKIGNASTKRPASGGGAKTPQKKPKLSEDDEDDDEDEDDDEDDEDDLDDDEEEIKTPMKKPAREPAGKNMQKAKQNGKDSKPSTPASKTKTPDSKKDKSLTPKTPKVPLSLEEIKAKMQASVDKGCSLPKLEPKFANYVKNCFRTEDQKVIQALWQWRQTL"
misc_feature 121..420 /gene="NPM1" /gene_synonym="NO38" /note="Nucleoplasmin/nucleophosmin domain; Region: Nucleoplasmin; pfam03066" /db_xref="CDD:460792" misc_feature 232..234 /gene="NPM1" /gene_synonym="NO38" /note="Interaction between pentamers. /evidence=ECO:0000250; propagated from UniProtKB/Swiss-Prot (P16039.1); other site" misc_feature 307..309 /gene="NPM1" /gene_synonym="NO38" /note="Interaction between pentamers. /evidence=ECO:0000250; propagated from UniProtKB/Swiss-Prot (P16039.1); other site" misc_feature 424..795 /gene="NPM1" /gene_synonym="NO38" /note="propagated from UniProtKB/Swiss-Prot (P16039.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 520..537 /gene="NPM1" /gene_synonym="NO38" /note="propagated from UniProtKB/Swiss-Prot (P16039.1); Region: Nuclear localization signal. /evidence=ECO:0000255" misc_feature 631..651 /gene="NPM1" /gene_synonym="NO38" /note="propagated from UniProtKB/Swiss-Prot (P16039.1); Region: Nuclear localization signal. /evidence=ECO:0000255" misc_feature 796..942 /gene="NPM1" /gene_synonym="NO38" /note="Nucleophosmin C-terminal domain; Region: NPM1-C; pfam16276" /db_xref="CDD:465081" exon 128..207 /gene="NPM1" /gene_synonym="NO38" /inference="alignment:Splign:2.1.0" exon 208..327 /gene="NPM1" /gene_synonym="NO38" /inference="alignment:Splign:2.1.0" exon 328..421 /gene="NPM1" /gene_synonym="NO38" /inference="alignment:Splign:2.1.0" exon 422..525 /gene="NPM1" /gene_synonym="NO38" /inference="alignment:Splign:2.1.0" exon 526..587 /gene="NPM1" /gene_synonym="NO38" /inference="alignment:Splign:2.1.0" exon 588..642 /gene="NPM1" /gene_synonym="NO38" /inference="alignment:Splign:2.1.0" exon 643..732 /gene="NPM1" /gene_synonym="NO38" /inference="alignment:Splign:2.1.0" exon 733..834 /gene="NPM1" /gene_synonym="NO38" /inference="alignment:Splign:2.1.0" exon 835..909 /gene="NPM1" /gene_synonym="NO38" /inference="alignment:Splign:2.1.0" exon 910..1268 /gene="NPM1" /gene_synonym="NO38" /inference="alignment:Splign:2.1.0" ORIGIN
agtgcgcgtccgtccgcagcgccgcatcccgtacagctcctcccgcgcgagcaggccgagaagatggaggacagcgccatggacatggagagcatgggcccgctgcgcccgcagaccttcctcttcggctgcgagcttaaagcagagaaggaatatcagttcaaagtagatgatgaggaaaacgagcatcagctgtccttgagaacggttacattaggggctggagccaaagacgaattacatgttgtagaagcagaagcactggactacgaaggcaacccaactaaagtagtactggcatctctgaaaatgtctgtgcagcctacagtttcactaggtggatttgagatcacaccaccagttgtcttgaggttaaaatgtggttcggggcctgtttatgtcagtggtcagcatcttgtagcattagaggaagagccagaatcagaggatgaggaggaggatacaaaaatagggaatgcttcaacaaagagaccagcaagtggaggaggagctaaaacaccacagaaaaaaccaaaattatcagaagatgatgaggacgatgatgaagatgaggatgatgatgaggatgatgaagacgacttggatgatgatgaggaggagattaaaacaccaatgaagaaacctgcccgcgagcctgcaggaaaaaatatgcagaaagcaaagcaaaatggaaaagactcaaagccgtccacaccagcatctaaaacaaaaactccagattccaagaaggacaaatctctaactccaaaaacaccgaaagttcctctgtcgttagaggagatcaaagcaaaaatgcaggcctccgtagacaagggttgttcccttcctaagctggagcccaaatttgccaactatgttaagaattgcttcaggacggaggaccaaaaggtcattcaagctctctggcagtggagacagactctgtaagagaacaatttaaacagtttgttaaagtctgcagtcttacttctgtaaccattatttggctgttctttttacaaatgctgaaagagctttccctacagtgtctgataaatgtcatccagattaccttgccaagaatgtgttgtccaaaatgcctgtttagtttttaaagatgggactccaccctcagcttcattttaagtatgtatggaatgttttgataaggcatggtggtgtggtggtggtggtcagacaaatggaagtggtgggaagactaaatgtacgtggaaaaaaaaaataaaatttagtattttaataaagta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]