2025-09-19 00:39:52, GGRNA.v2 : RefSeq release 231 (Jul, 2025)
LOCUS NM_205068 1839 bp mRNA linear VRT 30-APR-2025 DEFINITION Gallus gallus gastrulation brain homeobox 2 (GBX2), mRNA. ACCESSION NM_205068 VERSION NM_205068.2 KEYWORDS RefSeq. SOURCE Gallus gallus (chicken) ORGANISM Gallus gallus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes; Phasianidae; Phasianinae; Gallus. REFERENCE 1 (bases 1 to 1839) AUTHORS Tang,H., Finn,R.D. and Thomas,P.D. TITLE TreeGrafter: phylogenetic tree-based annotation of proteins with Gene Ontology terms and other annotations JOURNAL Bioinformatics 35 (3), 518-520 (2019) PUBMED 30032202 REFERENCE 2 (bases 1 to 1839) AUTHORS Roellig,D. and Bronner,M.E. TITLE The epigenetic modifier DNMT3A is necessary for proper otic placode formation JOURNAL Dev Biol 411 (2), 294-300 (2016) PUBMED 26826496 REMARK GeneRIF: DNMT3A is important for enabling the activation of Gbx2 expression, necessary for normal development of the inner ear REFERENCE 3 (bases 1 to 1839) AUTHORS Steventon,B., Mayor,R. and Streit,A. TITLE Mutual repression between Gbx2 and Otx2 in sensory placodes reveals a general mechanism for ectodermal patterning JOURNAL Dev Biol 367 (1), 55-65 (2012) PUBMED 22564795 REMARK GeneRIF: Otx2 and Gbx2 provide a global mechanism for patterning of the embryonic ectoderm and ensure the coordinated development of the central and peripheral nervous system in the head. REFERENCE 4 (bases 1 to 1839) AUTHORS Burge,S., Kelly,E., Lonsdale,D., Mutowo-Muellenet,P., McAnulla,C., Mitchell,A., Sangrador-Vegas,A., Yong,S.Y., Mulder,N. and Hunter,S. TITLE Manual GO annotation of predictive protein signatures: the InterPro approach to GO curation JOURNAL Database (Oxford) 2012, bar068 (2012) PUBMED 22301074 REMARK Publication Status: Online-Only REFERENCE 5 (bases 1 to 1839) AUTHORS Merchan,P., Bardet,S.M., Puelles,L. and Ferran,J.L. TITLE Comparison of Pretectal Genoarchitectonic Pattern between Quail and Chicken Embryos JOURNAL Front Neuroanat 5, 23 (2011) PUBMED 21503155 REMARK Publication Status: Online-Only REFERENCE 6 (bases 1 to 1839) AUTHORS Miyazaki,H., Kobayashi,T., Nakamura,H. and Funahashi,J. TITLE Role of Gbx2 and Otx2 in the formation of cochlear ganglion and endolymphatic duct JOURNAL Dev Growth Differ 48 (7), 429-438 (2006) PUBMED 16961590 REMARK GeneRIF: Results suggest that the interaction between Gbx2 and Otx2 in developing inner ear defines Fgf10 expression domain to induce the cochlear ganglion and that Gbx2 expression is important for the formation of the endolymphatic duct. REFERENCE 7 (bases 1 to 1839) AUTHORS Sanchez-Calderon,H., Martin-Partido,G. and Hidalgo-Sanchez,M. TITLE Otx2, Gbx2, and Fgf8 expression patterns in the chick developing inner ear and their possible roles in otic specification and early innervation JOURNAL Gene Expr Patterns 4 (6), 659-669 (2004) PUBMED 15465488 REMARK GeneRIF: Otx2, Gbx2, and Fgf8 are expressed in the chick developing inner ear REFERENCE 8 (bases 1 to 1839) AUTHORS Kowenz-Leutz,E., Herr,P., Niss,K. and Leutz,A. TITLE The homeobox gene GBX2, a target of the myb oncogene, mediates autocrine growth and monocyte differentiation JOURNAL Cell 91 (2), 185-195 (1997) PUBMED 9346236 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from JAENSK010000235.1. On Oct 19, 2021 this sequence version replaced NM_205068.1. ##Evidence-Data-START## Transcript exon combination :: AF022151.1, BI393586.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA103992440, SAMEA103992453 [ECO:0000348] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-768 JAENSK010000235.1 5210503-5211270 769-1839 JAENSK010000235.1 5211730-5212800 FEATURES Location/Qualifiers source 1..1839 /organism="Gallus gallus" /mol_type="mRNA" /db_xref="taxon:9031" /chromosome="7" /map="7" gene 1..1839 /gene="GBX2" /gene_synonym="GBX1" /note="gastrulation brain homeobox 2" /db_xref="CGNC:10048" /db_xref="GeneID:395950" exon 1..768 /gene="GBX2" /gene_synonym="GBX1" /inference="alignment:Splign:2.1.0" misc_feature 141..143 /gene="GBX2" /gene_synonym="GBX1" /note="upstream in-frame stop codon" CDS 273..1295 /gene="GBX2" /gene_synonym="GBX1" /note="gastrulation brain homeo box 2; gastrulation and brain-specific homeobox protein 2; gastrulation brain homeobox 2 protein; gastrulation brain homeobox 1" /codon_start=1 /product="homeobox protein GBX-2" /protein_id="NP_990399.1" /db_xref="CGNC:10048" /db_xref="GeneID:395950" /translation="
MSAAFQPSLMMMQRPLGSSTAFSIDSLIGSPPPPAPGHFVYTGYPMFMPYRPVVLPPPPPALPQAALQPPLPPAPPPPLPALPGAFCPGLAQGMALTSTLMAALPGSFPASPPRPEAARKFAPPGNFDKADGLPPPDGGGGGGDDGKTGGGLLPFPAADAVHASLAGALRGGPKDDPKAEEEAKGREENFSMDSDLDYSSDENGPAPAAPREEDCGTALEENPPSAANAAANAAATGKNRRRRTAFTSEQLLELEKEFHCKKYLSLTERSQIAHALKLSEVQVKIWFQNRRAKWKRVKAGNASSKAGEPSRNPKIVVPIPVHVSRFAIRSQHQQLEQARP"
misc_feature 588..737 /gene="GBX2" /gene_synonym="GBX1" /note="propagated from UniProtKB/Swiss-Prot (O42230.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 771..998 /gene="GBX2" /gene_synonym="GBX1" /note="propagated from UniProtKB/Swiss-Prot (O42230.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 990..1160 /gene="GBX2" /gene_synonym="GBX1" /note="Region: Homeodomain; pfam00046" /db_xref="CDD:459649" exon 769..1839 /gene="GBX2" /gene_synonym="GBX1" /inference="alignment:Splign:2.1.0" ORIGIN
aaaatgtgaatgggcgcgggggagcgggcgggcagaggcagcgcggtgcggggcggcggggggcggccggccccgatgtgcgggcggcggcggccccgctccgccccggctcggccccacgcgtgggcgctgcgcggcgctgagctgcgggagccggagcccgagcccgagcaagaggaggaggaggaggaggaggaggaggaggaggaagaagaagaagaggaggaggaggaggaagaaggtggtcgccgctgctcctccgccggcccggcatgagcgcggctttccagccctcgctgatgatgatgcagcgcccgctgggaagcagcacggccttcagcatcgattcgctcatcggcagccccccgccgcccgcccccggccacttcgtctacaccggctaccccatgttcatgccgtaccggcccgtcgtgctgccccccccgccgcccgccctgccgcaggccgccctgcagccgccgttgccccccgcgccgcccccgccgctgcccgcgttgcccggagccttctgccccgggctggcgcagggcatggccctcacctccacgctgatggccgcgctgcccggctccttccccgcctccccgccgcgccccgaggccgccaggaagttcgcccccccggggaacttcgacaaggccgacggactgcctcccccggacggcggcggcggcggcggagacgacggcaaaaccgggggggggctgctacccttccccgctgccgacgccgtgcacgcatcgctggccggggccctccgcggcggccccaaagacgatcccaaagcggaggaggaggcgaagggccgcgaggagaacttctccatggacagcgacctcgactacagctccgacgagaacggccccgcgccggcggccccgcgggaggaggactgtggcaccgcgttggaggagaacccccccagcgccgccaacgccgccgccaacgccgcggccacggggaagaaccgacggcggcggacggcgttcaccagcgagcagctgctggagctggagaaggagttccactgcaagaagtacctctcgctgacggagcgctcgcagatcgcgcacgccctgaagctgagcgaggtgcaggtgaagatctggttccagaacaggcgagccaaatggaagcgggtgaaggcgggcaacgccagctccaaggcgggggaaccgtcgcggaaccccaagatcgtcgtgcccatccccgtgcacgtcagccgcttcgccatcaggagtcagcaccagcagctggagcaggcgcggccctgagcgccgctgggggggcaaaaaagttgacaaccggggttttcgccggacccgctctgaaaagcgaaacgagcgacggaaaccaacccaaacagacgaaaacgacccaagcgaacgacccaaacgaacgcctccccgcccccccaaaatgaacctagaagcgacgcgactccaccggcgacccacgagcgatacggcggagccccacgccggcagcgagcggcagaactgaaggcggaacgccgcgcggagcggggccggggaccgggaccgcatcgccccgcagcgccacgggataacggcgctgggggagccgtcggtgcggggccgcccctcgcagagccgcgttgagaggagagggggagagagagagagagaggaggggaggggggggaggaggacggacggacggacggacagacggacaccgaggaaagcacgaattcagcgttgtggtttaatttatttcgatgtagcccgtttccttctaagttatgaaatttaaggagccaactcccgtcttgtgaataaaagccgacaaagaaac
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]