2024-07-01 22:54:43, GGRNA.v2 : RefSeq release 224 (May, 2024)
LOCUS NM_205012 1379 bp mRNA linear VRT 17-FEB-2024 DEFINITION Gallus gallus HESX homeobox 1 (HESX1), mRNA. ACCESSION NM_205012 VERSION NM_205012.3 KEYWORDS RefSeq. SOURCE Gallus gallus (chicken) ORGANISM Gallus gallus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes; Phasianidae; Phasianinae; Gallus. REFERENCE 1 (bases 1 to 1379) AUTHORS Tang,H., Finn,R.D. and Thomas,P.D. TITLE TreeGrafter: phylogenetic tree-based annotation of proteins with Gene Ontology terms and other annotations JOURNAL Bioinformatics 35 (3), 518-520 (2019) PUBMED 30032202 REFERENCE 2 (bases 1 to 1379) AUTHORS Spieler,D., Baumer,N., Stebler,J., Koprunner,M., Reichman-Fried,M., Teichmann,U., Raz,E., Kessel,M. and Wittler,L. TITLE Involvement of Pax6 and Otx2 in the forebrain-specific regulation of the vertebrate homeobox gene ANF/Hesx1 JOURNAL Dev Biol 269 (2), 567-579 (2004) PUBMED 15110720 REFERENCE 3 (bases 1 to 1379) AUTHORS Peale,F.V. Jr., Mason,K., Hunter,A.W. and Bothwell,M. TITLE Multiplex display polymerase chain reaction amplifies and resolves related sequences sharing a single moderately conserved domain JOURNAL Anal Biochem 256 (2), 158-168 (1998) PUBMED 9473273 REFERENCE 4 (bases 1 to 1379) AUTHORS Kazanskaya,O.V., Severtzova,E.A., Barth,K.A., Ermakova,G.V., Lukyanov,S.A., Benyumov,A.O., Pannese,M., Boncinelli,E., Wilson,S.W. and Zaraisky,A.G. TITLE Anf: a novel class of vertebrate homeobox genes expressed at the anterior end of the main embryonic axis JOURNAL Gene 200 (1-2), 25-34 (1997) PUBMED 9373136 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from JAENSK010000252.1. On Dec 3, 2021 this sequence version replaced NM_205012.2. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. ##Evidence-Data-START## Transcript exon combination :: CR352461.1 [ECO:0000332] RNAseq introns :: mixed sample support SAMEA103992290, SAMEA103992323 [ECO:0006172] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-192 JAENSK010000252.1 5756715-5756906 c 193-296 JAENSK010000252.1 5754753-5754856 c 297-425 JAENSK010000252.1 5751623-5751751 c 426-693 JAENSK010000252.1 5749712-5749979 c 694-899 JAENSK010000252.1 5749388-5749593 c 900-1001 JAENSK010000252.1 5749004-5749105 c 1002-1379 JAENSK010000252.1 5747699-5748076 c FEATURES Location/Qualifiers source 1..1379 /organism="Gallus gallus" /mol_type="mRNA" /db_xref="taxon:9031" /chromosome="12" /map="12" gene 1..1379 /gene="HESX1" /gene_synonym="GANF" /note="HESX homeobox 1" /db_xref="CGNC:4101" /db_xref="GeneID:395864" exon 1..192 /gene="HESX1" /gene_synonym="GANF" /inference="alignment:Splign:2.1.0" exon 193..296 /gene="HESX1" /gene_synonym="GANF" /inference="alignment:Splign:2.1.0" exon 297..425 /gene="HESX1" /gene_synonym="GANF" /inference="alignment:Splign:2.1.0" exon 426..693 /gene="HESX1" /gene_synonym="GANF" /inference="alignment:Splign:2.1.0" misc_feature 429..431 /gene="HESX1" /gene_synonym="GANF" /note="upstream in-frame stop codon" CDS 468..1100 /gene="HESX1" /gene_synonym="GANF" /note="homeodomain-containing protein; anterior neural fold protein; homeobox protein GANF; homeo box (expressed in ES cells) 1; homeobox, ES cell expressed 1" /codon_start=1 /product="homeobox protein ANF-1" /protein_id="NP_990343.3" /db_xref="CGNC:4101" /db_xref="GeneID:395864" /translation="
MCCAVLAEGETMASTSLCAANPSASQNLRKVSGFVENKTTQCSFSIESILGLEQKKDGIAAVKPHRPWMDVCTNLVLGDDSDPHLQIPVVSYENSLFHANSNLMQEEKVLNCEKYFSVTERLSFKRELSWYRGRRPRTAFTRNQIEVLENVFKMNSYPGIDIREELARKLDLEEDRIQIWFQNRRAKLKRSHRESQFLMVKNNFTSSLLE"
misc_feature 867..1037 /gene="HESX1" /gene_synonym="GANF" /note="Region: Homeodomain; pfam00046" /db_xref="CDD:459649" exon 694..899 /gene="HESX1" /gene_synonym="GANF" /inference="alignment:Splign:2.1.0" exon 900..1001 /gene="HESX1" /gene_synonym="GANF" /inference="alignment:Splign:2.1.0" exon 1002..1379 /gene="HESX1" /gene_synonym="GANF" /inference="alignment:Splign:2.1.0" ORIGIN
ctgacgggaggtggtttgtggttcgggttgctttcgcgcgcgatgagcggcgggagctgcgcctcgcgcctcgcgcctcggagctggcgcttacctgcgcggcggagcgctgcgggactgccgccaccgcgtcctgtcagggtggggacgtccctcccgctcttggtgcgggagctcgttaggctgagccagggagaagagcagccaacggctcttttaaggatttcagatgtgtcccctaatggagagaactttggctctgctgaggagtggaattagctgactggatcaggtagttcatgggagtgtggatcatgcatatgaagacagccttactgagagatgagtcccgtgggccttgttactctttctcaatgctgacatgatcagaaggcatggcagtagccagtgagctgcttatacagctataaggaggacttctggagaaatgcaagtacagtgagtgtatgtgctgtgctgtgctggctgaaggtgaaaccatggcaagtacatcgctgtgtgcagctaatccatcagcatctcagaatcttcggaaagtgtctggttttgtagaaaataaaaccacacagtgctcattttccattgaaagtattttaggattggagcagaagaaggatggcattgcagctgtgaaacctcacagaccgtggatggatgtgtgcaccaacttggttttaggtgatgacagtgatccacatctgcaaatccctgttgtttcctatgaaaattcattatttcatgctaacagtaatctaatgcaagaggaaaaagttttgaactgtgaaaaatatttttcagtcactgaaaggttatctttcaaacgagaattgagctggtataggggtagaagaccgagaactgctttcactagaaaccagattgaagtcttggaaaatgtttttaaaatgaactcctaccctggcattgatattagagaagaattagctcgcaagttagatttagaggaagacaggatccagatctggttccagaaccgtcgtgcaaaactgaagagatcccaccgagaatcacagtttttaatggtgaaaaataatttcacctccagcctgctagagtaggaggaaggatggtttgccttgatgttactacaatgggacttgaagaattactggcattgttgtaatttgtattaaacaatgattatgtattaattatgattttatccctagatttgaaagattatcatttttcactcaaataaactgtaaatatgtgaagtattgtaaactaatttttgtggagaaagtgaacttttcctatatattttaataaatatgttcagaaaagtttaaatattttttgcagttaaaaaataaaccgtaagttctgggttgtgt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]