GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-08-24 02:15:06, GGRNA.v2 : RefSeq release 230 (May, 2025)

LOCUS       NM_204768               2186 bp    mRNA    linear   VRT 03-APR-2024
DEFINITION  Gallus gallus visual system homeobox 2 (VSX2), mRNA.
ACCESSION   NM_204768
VERSION     NM_204768.1
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
REFERENCE   1  (bases 1 to 2186)
  AUTHORS   Tang,H., Finn,R.D. and Thomas,P.D.
  TITLE     TreeGrafter: phylogenetic tree-based annotation of proteins with
            Gene Ontology terms and other annotations
  JOURNAL   Bioinformatics 35 (3), 518-520 (2019)
   PUBMED   30032202
REFERENCE   2  (bases 1 to 2186)
  AUTHORS   Wang,Z., Yasugi,S. and Ishii,Y.
  TITLE     Chx10 functions as a regulator of molecular pathways controlling
            the regional identity in the primordial retina
  JOURNAL   Dev Biol 413 (1), 104-111 (2016)
   PUBMED   27001188
  REMARK    GeneRIF: Chx10 can function as a cell autonomous regulator of the
            regional identity in the primordial retina, presumably through a
            downstream transcriptional cascade
REFERENCE   3  (bases 1 to 2186)
  AUTHORS   Burge,S., Kelly,E., Lonsdale,D., Mutowo-Muellenet,P., McAnulla,C.,
            Mitchell,A., Sangrador-Vegas,A., Yong,S.Y., Mulder,N. and Hunter,S.
  TITLE     Manual GO annotation of predictive protein signatures: the InterPro
            approach to GO curation
  JOURNAL   Database (Oxford) 2012, bar068 (2012)
   PUBMED   22301074
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 2186)
  AUTHORS   Dorval,K.M., Bobechko,B.P., Fujieda,H., Chen,S., Zack,D.J. and
            Bremner,R.
  TITLE     CHX10 targets a subset of photoreceptor genes
  JOURNAL   J Biol Chem 281 (2), 744-751 (2006)
   PUBMED   16236706
  REMARK    GeneRIF: CHX10 may target specific motifs to inhibit rod
            photoreceptor gene expression in bipolar cells
REFERENCE   5  (bases 1 to 2186)
  AUTHORS   Rowan,S. and Cepko,C.L.
  TITLE     A POU factor binding site upstream of the Chx10 homeobox gene is
            required for Chx10 expression in subsets of retinal progenitor
            cells and bipolar cells
  JOURNAL   Dev Biol 281 (2), 240-255 (2005)
   PUBMED   15893976
  REMARK    GeneRIF: Chx10 expression in subsets of retinal progenitor cells
            and bipolar ells requires a POU factor binding site upstream of the
            Chx10 gene
REFERENCE   6  (bases 1 to 2186)
  AUTHORS   Dorval,K.M., Bobechko,B.P., Ahmad,K.F. and Bremner,R.
  TITLE     Transcriptional activity of the paired-like homeodomain proteins
            CHX10 and VSX1
  JOURNAL   J Biol Chem 280 (11), 10100-10108 (2005)
   PUBMED   15647262
  REMARK    GeneRIF: CHX10 and VSX1 may control retinal bipolar cell
            specification or differentiation by repressing genes required for
            the development of other cell types
REFERENCE   7  (bases 1 to 2186)
  AUTHORS   Chen,C.M. and Cepko,C.L.
  TITLE     Expression of Chx10 and Chx10-1 in the developing chicken retina
  JOURNAL   Mech Dev 90 (2), 293-297 (2000)
   PUBMED   10640715
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AF178671.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AF178671.1, SRR13267659.198103.1
                                           [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA3109051 [ECO:0000348]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..2186
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /db_xref="taxon:9031"
                     /chromosome="5"
                     /map="5"
     gene            1..2186
                     /gene="VSX2"
                     /gene_synonym="CHX10"
                     /note="visual system homeobox 2"
                     /db_xref="CGNC:7768"
                     /db_xref="GeneID:395536"
     exon            1..435
                     /gene="VSX2"
                     /gene_synonym="CHX10"
                     /inference="alignment:Splign:2.1.0"
     CDS             9..1142
                     /gene="VSX2"
                     /gene_synonym="CHX10"
                     /note="homeobox protein Chx10; ceh-10 homeodomain
                     containing homolog; ceh-10 homeo domain containing
                     homolog"
                     /codon_start=1
                     /product="visual system homeobox 2"
                     /protein_id="NP_990099.1"
                     /db_xref="CGNC:7768"
                     /db_xref="GeneID:395536"
                     /translation="
MTGKAGAALAPSLPGKPKPDGAAAAAPPPPPPAAGAKPSSGPTPPRCTGFGIQEILGLNKEPPSHPRAALDSLPAGHLLAARSVLSPAGVGGVGMGLLGAGGIPGFYAQPTFLEVLSDPQSVHLQPLARAPGQLDSSQTASSDSEDVSSSDRKMSKSSLNQSKKRKKRRHRTIFTSYQLEELEKAFNEAHYPDVYAREMLAMKTELPEDRIQVWFQNRRAKWRKREKCWGRSSVMAEYGLYGAMVRHSIPLPESILKSAKDGIMESCAPWLLGMHKKSLEAAAEAGRKTEVERQALPKLDKGDKEERGSDPKTAISQEELRENSIAALRAKAQEHSTKVLGTIAGDTPRKPEKGEEVAEDERQTEKSSASQKEEKLI"
     misc_feature    9..158
                     /gene="VSX2"
                     /gene_synonym="CHX10"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9IAL1.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    393..518
                     /gene="VSX2"
                     /gene_synonym="CHX10"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9IAL1.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    522..680
                     /gene="VSX2"
                     /gene_synonym="CHX10"
                     /note="Region: Homeodomain; pfam00046"
                     /db_xref="CDD:459649"
     misc_feature    861..1139
                     /gene="VSX2"
                     /gene_synonym="CHX10"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9IAL1.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    963..1019
                     /gene="VSX2"
                     /gene_synonym="CHX10"
                     /note="OAR motif; Region: OAR; pfam03826"
                     /db_xref="CDD:461067"
     misc_feature    975..1016
                     /gene="VSX2"
                     /gene_synonym="CHX10"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9IAL1.1);
                     Region: OAR.
                     /evidence=ECO:0000255|PROSITE-ProRule:PRU00138"
     exon            436..520
                     /gene="VSX2"
                     /gene_synonym="CHX10"
                     /inference="alignment:Splign:2.1.0"
     exon            521..644
                     /gene="VSX2"
                     /gene_synonym="CHX10"
                     /inference="alignment:Splign:2.1.0"
     exon            645..825
                     /gene="VSX2"
                     /gene_synonym="CHX10"
                     /inference="alignment:Splign:2.1.0"
     exon            826..2186
                     /gene="VSX2"
                     /gene_synonym="CHX10"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
gccgcagcatgacgggcaaagcgggcgcggcgctggcccccagcctgcctggcaagcccaagcccgacggcgcggccgccgccgccccgccgccgccgccccccgcggcgggagccaagcccagctccgggcccacccctcctcgctgcaccggcttcggcatccaggagatcctgggcttgaacaaggaaccgccgtcgcacccgcgggccgccctggactcgctgcccgccgggcacctgctggcggcccgctccgtcctcagccccgccggggtgggcggcgtgggcatggggctgctgggggccggaggcatccccggcttctacgcgcagcccacctttctggaggtgctctccgacccgcagagcgtccacctgcagcctttggcccgagcccccgggcagctggacagcagccagacggccagctcagattccgaggatgtctcctccagcgaccgcaaaatgtccaaatcttccctcaaccagagcaagaaacgaaagaagaggcggcacaggacaatcttcacatcctaccaactggaagagctggaaaaggccttcaatgaggctcactaccctgatgtgtatgctagagagatgctggccatgaaaacagagctgccagaagacaggatacaggtctggttccagaaccgccgggccaagtggcggaagcgagagaagtgctggggccggagcagcgtgatggctgagtatgggctctatggagccatggtgcgccactccatcccgctgcctgagtccatcctcaagtcagccaaggacggcatcatggagtcctgcgccccatggctcctggggatgcacaaaaagtctctggaggcagcggctgaggcggggaggaagacggaggtggagcgccaggccctgcccaagcttgacaagggtgacaaggaagagaggggctcggatcccaaaaccgccatttcccaggaggaactgagagaaaacagcattgccgccctcagggccaaagctcaggagcacagcaccaaagtcctggggaccattgcgggggacaccccgaggaagccggaaaaaggggaggaagtggcagaggatgagaggcagacagagaagtccagtgcatcacagaaagaggagaagctgatctagggggacagaggctgcggaagccagccctgacagatactgtgtcctctgggggtcacagcccctctgatggccaggcctggcacccacccagggtgtggggccctggtttcttcacgtggggctaccccaagggtaccccaggctaccccagcctgctcccctgaagcgcagcctgtacttcactcctctactctttgggctttccttaccccagcccatccccatctccatcgtcaccccagggcaggctgcggctccaggtccctctggttgcggtcctgggcctagcctaaggtaccatccagccccctccaggccggtgaagcccagatccccttcacctcacgccccatcccgctgtgttccacaccccaggggaccccactgcccctggcacgatgagcccatggccctgtgtgtgtgaaacgctgagctacttggctctcccagctcagcactgacagctgctgggatggggctgctggtttggagtggctgatttgtgcctccattacgtgaggaaacgcaggtttagcttgcagatgccatgccccgttcccagctcacagctccagtgacctcagcctacaccgtcatctccccctatcgcactcggaggccagtgccacacacagctaaagcctctcaggctagacaacattttcccaaggtatttattgaagtaaattgccctgctctccttctgagcctgaagggaatgacagccatgcagatgcacccccggcacacactgtaatgtgtacatacgtctcctcactgacccatgtgtgcacgcagacccacgcagccaaacccgctgtacttcacagcatcccgtgctgacattgcccttctatcccagccaggcaccctctccccagagctgctgtttttattctgtcagaagtaaccccttccatccagccccatctgtctttgtcccccgtttgtttgacgtgttagattatagcccacgctgtgtaaataatgtacatacagtgagaaaagaattcagtattgaggtgtttgagatatggagctgta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]