GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-07-01 22:07:21, GGRNA.v2 : RefSeq release 224 (May, 2024)

LOCUS       NM_204512                954 bp    mRNA    linear   VRT 03-APR-2024
DEFINITION  Gallus gallus brain specific homeobox (BSX), mRNA.
ACCESSION   NM_204512
VERSION     NM_204512.1
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
REFERENCE   1  (bases 1 to 954)
  AUTHORS   Burge,S., Kelly,E., Lonsdale,D., Mutowo-Muellenet,P., McAnulla,C.,
            Mitchell,A., Sangrador-Vegas,A., Yong,S.Y., Mulder,N. and Hunter,S.
  TITLE     Manual GO annotation of predictive protein signatures: the InterPro
            approach to GO curation
  JOURNAL   Database (Oxford) 2012, bar068 (2012)
   PUBMED   22301074
  REMARK    Publication Status: Online-Only
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AY500594.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AY500594.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN03579563, SAMN08016555
                                           [ECO:0000348]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..954
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /db_xref="taxon:9031"
                     /chromosome="24"
                     /map="24"
     gene            1..954
                     /gene="BSX"
                     /note="brain specific homeobox"
                     /db_xref="CGNC:4913"
                     /db_xref="GeneID:395183"
     exon            1..343
                     /gene="BSX"
                     /inference="alignment:Splign:2.1.0"
     CDS             76..777
                     /gene="BSX"
                     /note="brain-specific homeodomain protein"
                     /codon_start=1
                     /product="brain-specific homeobox protein homolog"
                     /protein_id="NP_989843.1"
                     /db_xref="CGNC:4913"
                     /db_xref="GeneID:395183"
                     /translation="
MNLNFTSPVHPVPAPRPTSFFIEDILLHKPKPLREVPPEHFAGSLASRVPLLDYGYPLMPAPALLAPHPHPALHKPEHHHHHPYFLTTSGVPVPALFPHHAHAELPGKHCRRRKARTVFSDSQLSGLEKRFEIQRYLSTPERVELATALSLSETQVKTWFQNRRMKHKKQLRKSQDDPIHEENREQSSPEPELPEPAAAEPRKGPPGPFLLQDPEDEVDILEEGDILAAPHRL"
     misc_feature    412..582
                     /gene="BSX"
                     /note="Region: Homeodomain; pfam00046"
                     /db_xref="CDD:459649"
     misc_feature    565..729
                     /gene="BSX"
                     /note="propagated from UniProtKB/Swiss-Prot (Q6RFL5.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     exon            344..540
                     /gene="BSX"
                     /inference="alignment:Splign:2.1.0"
     exon            541..954
                     /gene="BSX"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
gccggccgccctttctcctccggcccccagccccgctcgctccgttccccgcaatccgacgcggggccctccgagatgaacctcaacttcacctctccggtacacccggtccccgcgccccgacccacctccttcttcatcgaggacatcctgctgcacaagcccaagcccctgcgggaggtgccccccgagcacttcgccggctccttggcatcccgcgtcccgctcttggactatgggtaccccctgatgcccgccccggcgctgctggctccacacccgcacccggccctgcataaaccggagcaccaccaccaccacccctacttcctcaccacctcgggagtgccggtgccggcgctgttcccgcaccacgctcacgccgagctgcccgggaagcactgccgccgccgcaaggcccgcaccgtcttctccgactctcagctctccggtctggagaagcgcttcgagatccagcgctatctctccacgccagagcgggtggagttggccacggcgctcagcctctccgagacgcaggtgaaaacctggttccagaaccggcggatgaaacacaaaaaacagctgcggaaaagccaggacgaccccatacacgaagagaaccgcgagcagagctcccccgagcccgagctccccgagccggccgcagccgagccccgaaagggcccccccggccccttcttgctgcaggaccccgaggacgaggtggacatcctggaggagggggatatcctcgccgccccacaccgcctttaggagctctcagggcagctttgcgcagccccgcatctctcccccagccccgcgtgctgccggggtgccgaggtttggtgtcggtacggaggggaacaaaacccccgggctcctttcgcccctttggctgcatcccagcgtcaccccaagcctgaactttgcttggaaatccagcggggg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]