2025-09-18 11:04:44, GGRNA.v2 : RefSeq release 231 (Jul, 2025)
LOCUS NM_001396189 1511 bp mRNA linear VRT 24-SEP-2023 DEFINITION Gallus gallus motor neuron and pancreas homeobox 1 (MNX1), mRNA. ACCESSION NM_001396189 VERSION NM_001396189.2 KEYWORDS RefSeq. SOURCE Gallus gallus (chicken) ORGANISM Gallus gallus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes; Phasianidae; Phasianinae; Gallus. REFERENCE 1 (bases 1 to 1511) AUTHORS Tang H, Finn RD and Thomas PD. TITLE TreeGrafter: phylogenetic tree-based annotation of proteins with Gene Ontology terms and other annotations JOURNAL Bioinformatics 35 (3), 518-520 (2019) PUBMED 30032202 REFERENCE 2 (bases 1 to 1511) AUTHORS Burge S, Kelly E, Lonsdale D, Mutowo-Muellenet P, McAnulla C, Mitchell A, Sangrador-Vegas A, Yong SY, Mulder N and Hunter S. TITLE Manual GO annotation of predictive protein signatures: the InterPro approach to GO curation JOURNAL Database (Oxford) 2012, bar068 (2012) PUBMED 22301074 REMARK Publication Status: Online-Only REFERENCE 3 (bases 1 to 1511) AUTHORS Tanabe Y, William C and Jessell TM. TITLE Specification of motor neuron identity by the MNR2 homeodomain protein JOURNAL Cell 95 (1), 67-80 (1998) PUBMED 9778248 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from JAENSK010000036.1. On Dec 10, 2021 this sequence version replaced NM_001396189.1. ##Evidence-Data-START## Transcript exon combination :: AF066861.1, SRR12888542.292859.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMN06143078 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: full length. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-604 JAENSK010000036.1 696216-696819 c 605-765 JAENSK010000036.1 694620-694780 c 766-1511 JAENSK010000036.1 693751-694496 c FEATURES Location/Qualifiers source 1..1511 /organism="Gallus gallus" /mol_type="mRNA" /db_xref="taxon:9031" /chromosome="2" /map="2" gene 1..1511 /gene="MNX1" /gene_synonym="HB9; HLXB9" /note="motor neuron and pancreas homeobox 1" /db_xref="CGNC:4851" /db_xref="GeneID:395768" exon 1..604 /gene="MNX1" /gene_synonym="HB9; HLXB9" /inference="alignment:Splign:2.1.0" CDS 67..1107 /gene="MNX1" /gene_synonym="HB9; HLXB9" /note="homeo box HB9; homeobox HB9" /codon_start=1 /product="motor neuron and pancreas homeobox protein 1" /protein_id="NP_001383118.1" /db_xref="CGNC:4851" /db_xref="GeneID:395768" /translation="
MEKSKNFRIDALLAVDPPKAAAQSAPLALVTGGSGGGSPPSSSSSSSSSSSSSSELPADCPRTDSPSPPRLLPAHCALLPKAAFLGGGGPGGGHPQHHALGLHPAGPGGPGLYGHPVYGYPALGGQHPALSYSYSQVQGAHPAHPSADPIKLSAGTFQLDQWLRASTAGMILPKMPDFGSQAQSNLLGKCRRPRTAFTSQQLLELEHQFKLNKYLSRPKRFEVATSLMLTETQVKIWFQNRRMKWKRSKKAKEQAAQEAEKQKGGGEDKAAEELLLPGPEKGGGRRLRELPDSEPEDEEEEEEEEEEAEAGRCCPYHSSDCSEADEEDSQSGGRPGAPPPPPAQPQ"
misc_feature 637..807 /gene="MNX1" /gene_synonym="HB9; HLXB9" /note="Region: Homeodomain; pfam00046" /db_xref="CDD:459649" exon 605..765 /gene="MNX1" /gene_synonym="HB9; HLXB9" /inference="alignment:Splign:2.1.0" exon 766..1511 /gene="MNX1" /gene_synonym="HB9; HLXB9" /inference="alignment:Splign:2.1.0" ORIGIN
actccgcccccgccgccgggagacgcggcccgggccgcggtgcctctcgccgcctccgccgctcccatggaaaaatccaaaaatttccgcatcgacgcgctgctggctgtcgatccccccaaggcggcggcgcagagcgctccgctggccctggtcaccggcggctccggcggcggcagccctccgtcttcgtcgtcctcctcgtcgtcgtcgtcctcctcttcttccgagctccccgccgactgcccgcgcaccgacagcccctctccgcctcgcctgctgcccgcgcactgcgcgctgctgcccaaagccgccttcctgggcggggggggacccgggggcggccacccgcagcaccacgccctggggctgcaccccgcggggccgggcgggccgggcctctacgggcacccggtgtacggctacccggcgttgggcgggcagcacccggcgctctcctattcctattcgcaagtgcagggagcgcaccccgcgcatccctccgccgaccccatcaagctgagcgccggcaccttccagctggaccagtggctgcgggcgagcacggccggcatgatcctgcccaaaatgcccgacttcggctctcaggcgcagtccaacctcctggggaagtgccggcggccgcgcaccgccttcaccagccagcagctgctggagctggagcaccagttcaagctcaacaagtacctctcccggcccaagcgcttcgaggtggccacgtcgctgatgctcaccgagacgcaggtgaagatttggttccagaaccgccgcatgaaatggaagcgcagcaaaaaggcgaaggagcaggcggcgcaggaggcagagaagcagaaaggaggaggagaggacaaagcggccgaggaactgctgctgcccggcccggagaaaggcggcgggaggcggctgagggagctgcccgacagcgagcccgaggacgaggaggaggaagaagaggaggaagaggaggccgaggccgggcggtgctgcccctaccactcctccgactgctccgaggcggacgaggaggactcgcagtccggaggacggcccggagcccccccgccaccccccgcacagccgcagtgagcccacggccgccccgtcggggccgcccccggcaacggagcctcctggccccgctctcccatccctccctgctcggagggggacgcggaaagggatctcccgtctgccgagcgggagggagaattcacacagtgttattattgactgagaagcggccacgacttgagcccccctccccgccccgccctatcggaaccgtttccttcttaccatatatcgggaaaagtgtttatgtcatgaacgttaaaactgctgcaaatctcaatactgtctttatttttgtatatcctatttataaaaaaggcaaaatgaattcctctacttatgcatgctaaattattacccagcccctcccgccctgaggtgggggggaggaatataaataaagagcgttttgtactgtg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]