GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-09-18 11:04:44, GGRNA.v2 : RefSeq release 231 (Jul, 2025)

LOCUS       NM_001396189            1511 bp    mRNA    linear   VRT 24-SEP-2023
DEFINITION  Gallus gallus motor neuron and pancreas homeobox 1 (MNX1), mRNA.
ACCESSION   NM_001396189
VERSION     NM_001396189.2
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
REFERENCE   1  (bases 1 to 1511)
  AUTHORS   Tang H, Finn RD and Thomas PD.
  TITLE     TreeGrafter: phylogenetic tree-based annotation of proteins with
            Gene Ontology terms and other annotations
  JOURNAL   Bioinformatics 35 (3), 518-520 (2019)
   PUBMED   30032202
REFERENCE   2  (bases 1 to 1511)
  AUTHORS   Burge S, Kelly E, Lonsdale D, Mutowo-Muellenet P, McAnulla C,
            Mitchell A, Sangrador-Vegas A, Yong SY, Mulder N and Hunter S.
  TITLE     Manual GO annotation of predictive protein signatures: the InterPro
            approach to GO curation
  JOURNAL   Database (Oxford) 2012, bar068 (2012)
   PUBMED   22301074
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1511)
  AUTHORS   Tanabe Y, William C and Jessell TM.
  TITLE     Specification of motor neuron identity by the MNR2 homeodomain
            protein
  JOURNAL   Cell 95 (1), 67-80 (1998)
   PUBMED   9778248
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JAENSK010000036.1.
            
            On Dec 10, 2021 this sequence version replaced NM_001396189.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AF066861.1, SRR12888542.292859.1
                                           [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN06143078 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-604               JAENSK010000036.1  696216-696819       c
            605-765             JAENSK010000036.1  694620-694780       c
            766-1511            JAENSK010000036.1  693751-694496       c
FEATURES             Location/Qualifiers
     source          1..1511
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /db_xref="taxon:9031"
                     /chromosome="2"
                     /map="2"
     gene            1..1511
                     /gene="MNX1"
                     /gene_synonym="HB9; HLXB9"
                     /note="motor neuron and pancreas homeobox 1"
                     /db_xref="CGNC:4851"
                     /db_xref="GeneID:395768"
     exon            1..604
                     /gene="MNX1"
                     /gene_synonym="HB9; HLXB9"
                     /inference="alignment:Splign:2.1.0"
     CDS             67..1107
                     /gene="MNX1"
                     /gene_synonym="HB9; HLXB9"
                     /note="homeo box HB9; homeobox HB9"
                     /codon_start=1
                     /product="motor neuron and pancreas homeobox protein 1"
                     /protein_id="NP_001383118.1"
                     /db_xref="CGNC:4851"
                     /db_xref="GeneID:395768"
                     /translation="
MEKSKNFRIDALLAVDPPKAAAQSAPLALVTGGSGGGSPPSSSSSSSSSSSSSSELPADCPRTDSPSPPRLLPAHCALLPKAAFLGGGGPGGGHPQHHALGLHPAGPGGPGLYGHPVYGYPALGGQHPALSYSYSQVQGAHPAHPSADPIKLSAGTFQLDQWLRASTAGMILPKMPDFGSQAQSNLLGKCRRPRTAFTSQQLLELEHQFKLNKYLSRPKRFEVATSLMLTETQVKIWFQNRRMKWKRSKKAKEQAAQEAEKQKGGGEDKAAEELLLPGPEKGGGRRLRELPDSEPEDEEEEEEEEEEAEAGRCCPYHSSDCSEADEEDSQSGGRPGAPPPPPAQPQ"
     misc_feature    637..807
                     /gene="MNX1"
                     /gene_synonym="HB9; HLXB9"
                     /note="Region: Homeodomain; pfam00046"
                     /db_xref="CDD:459649"
     exon            605..765
                     /gene="MNX1"
                     /gene_synonym="HB9; HLXB9"
                     /inference="alignment:Splign:2.1.0"
     exon            766..1511
                     /gene="MNX1"
                     /gene_synonym="HB9; HLXB9"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
actccgcccccgccgccgggagacgcggcccgggccgcggtgcctctcgccgcctccgccgctcccatggaaaaatccaaaaatttccgcatcgacgcgctgctggctgtcgatccccccaaggcggcggcgcagagcgctccgctggccctggtcaccggcggctccggcggcggcagccctccgtcttcgtcgtcctcctcgtcgtcgtcgtcctcctcttcttccgagctccccgccgactgcccgcgcaccgacagcccctctccgcctcgcctgctgcccgcgcactgcgcgctgctgcccaaagccgccttcctgggcggggggggacccgggggcggccacccgcagcaccacgccctggggctgcaccccgcggggccgggcgggccgggcctctacgggcacccggtgtacggctacccggcgttgggcgggcagcacccggcgctctcctattcctattcgcaagtgcagggagcgcaccccgcgcatccctccgccgaccccatcaagctgagcgccggcaccttccagctggaccagtggctgcgggcgagcacggccggcatgatcctgcccaaaatgcccgacttcggctctcaggcgcagtccaacctcctggggaagtgccggcggccgcgcaccgccttcaccagccagcagctgctggagctggagcaccagttcaagctcaacaagtacctctcccggcccaagcgcttcgaggtggccacgtcgctgatgctcaccgagacgcaggtgaagatttggttccagaaccgccgcatgaaatggaagcgcagcaaaaaggcgaaggagcaggcggcgcaggaggcagagaagcagaaaggaggaggagaggacaaagcggccgaggaactgctgctgcccggcccggagaaaggcggcgggaggcggctgagggagctgcccgacagcgagcccgaggacgaggaggaggaagaagaggaggaagaggaggccgaggccgggcggtgctgcccctaccactcctccgactgctccgaggcggacgaggaggactcgcagtccggaggacggcccggagcccccccgccaccccccgcacagccgcagtgagcccacggccgccccgtcggggccgcccccggcaacggagcctcctggccccgctctcccatccctccctgctcggagggggacgcggaaagggatctcccgtctgccgagcgggagggagaattcacacagtgttattattgactgagaagcggccacgacttgagcccccctccccgccccgccctatcggaaccgtttccttcttaccatatatcgggaaaagtgtttatgtcatgaacgttaaaactgctgcaaatctcaatactgtctttatttttgtatatcctatttataaaaaaggcaaaatgaattcctctacttatgcatgctaaattattacccagcccctcccgccctgaggtgggggggaggaatataaataaagagcgttttgtactgtg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]